Genomic Feature

tm15a

ID
ZDB-ALT-980203-1052
Name
tm15a
Synonyms
  • M015A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 51491337 (GRCz11) (1) Details
Nucleotide change
C/A
Variant Notes
The mutation is predicted to introduce a stop codon at the beginning of the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gly>Stop at position 781 (1)
Sequences
Flanking Sequence
CCCATAGCTAAGTCCTTCAGGAGCATCTCTGAGCTCCTCCTGAATCCAAGTATCAACTTCCCTGTAAAACTGGTGCATCTTCTCGTAGGCCAGAGTAAAATGGTAGGTACTTTGAAACTCGAGTACGATAGCTCGAATGGTGTCATTTATGTCAAACCTTGGTCCTGGAGTCTTGCTGTCAAGGTGGTAGATGGTGCTTCGGTCGAGCTCCATAATCGCCCGTTTGATGCACAACTCAAAGACGTCTTGTCTGTAGGGGAACGTGGATTGGCTACAACAGGGATAAACAGAGGCTTCTTCGCAGTCTTGGTTTTCCATCCACTGCTTGAAAGTCTCCATGAAGCAGCTTGTGAAGTCTTGCTCCTCGGATTGGTAAACGAAGCTCTGGTTTCTGAGCTTCTGGCAGAAATTGAGAATCCATACTTGACTCGCTGGACTCGCAATGTTGAAGGTTGTGTCAAGAGTTAGCTTTCCCTTGTTTTTAGGGTTTAGCGGATCTC
C/A GCTGTCAATCGGTGTAACCCCCCAAATGATTGTAATCGGCATGTGTAGGTCTTCCCCATGGTTGACCCGTTCAAACATGAAGAGTTTTTTGTACTCCGCATCATAGCGTTCAAAGGGATGCGAGGAGCGAAACACTTGAAATTCTGAGAGCTCCAAAGAGGGAAGTTTCATTTTGGGATTTACGCAAACCACATAAGCGCCACCTACTGTCAAAGCCAGGAACCACAAGAGCCACAAGTAGCGCAACTTGATCACGACACAAGGCAGAACTTTCTCGAAGAAAATCCTCGAGGCTTCAGAGATGCTAAAAAGACACTTGTTGACCACCTGGCACAGGCTTGTCCAAAACGTTGCAGCGCCCTGCGATTGATGGTTTTGTGTTCGTGAACATGTAAGAAGGTTAACCAGGTACCGCTCATGTAAGACCACCACAGCTGGCAACCAGGTAACCATCAGTATGTAGTTAACCAAGATAGCGGTTCCAGCATAGACACCGAAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations