Genomic Feature

swu46

ID
ZDB-ALT-181217-2
Name
swu46
Synonyms
  • Delta 10 taz (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Huang&Ruan Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 22: 38049696 - 38049705 (GRCz11) (1) Details
Nucleotide change
CCCGGGAGAC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TCAGAAACTCCGCGATCGGACGCAGGAGGAACAAAAAACTCTCCAAACTCCACGCGGGACAACATGACAAACGCCTTTCTAGCTTTATGACAACTTTTCGACGACTTACAAACACTTTTCAACTCGGCTGAAACTACTTAAGGACGAAAAACAGGAAAAGTTCCTACAGGAATTTTTTTTTCCATCGGCCATTTTAATCGAAGTTTGTTTTGACCATGAGCGGTAATCCTCTCCAGCCGATACCGGGCCACCAGGTGATCCATGTCGCCAAAGACCTGGACACGGATCTGGAGGCTCTTTTTAACTCGGTCATGAACCCGAAACCGAGCTCCTGGAGGAACAAGGATATGCCGCAGTCTTTCTTCCAGGAGCCGGACTCGGGCTCCCACTCCCGGCAGTCCAGCGCGGACTCCGGTTCTCTCCCGCCGAGGGTCCACTTTCGCTCGCGCTCATCTCCGGCGTCCCTACAGCTGCCGGCGGGCTCCGTGAGCGGCCCGAGC
CCCGGGAGAC/- TCCACTCCCACACCCGGCACCAGTCCTGCGATGTGGCCGAGGAGCTGCCGCTGCCCCCTGGGTGGGAGATGGCCTTCACCCCCAACGGCCAGAAGTACTTTCTCAAGTAAGAGTTCGTTATTACTGGACATTCCTGCACACTGTTTAGTTCACATTACCAGTTAGTGGAGTGCATACAGTGGGGGGAATGAGTATTGAACACGGTCCTGTTTTGATTTCCTGGGAATAATATTCATAAAGGAGCTGTTGATATGGAGTTTAACCAGATTTTGGTAGAAACCAAAACAATACAAACATAAAAACGAAATAAAACAAAACAAAAGTGAGTTCTGTGTAATAACAATGAAATAATACAAGTACTGAACTACTGGAATGTATTTAATACTGTAAATAAAAGTCTTTTTTAAAGGCTCCTCTGATATGGAGATAGAAGGCACATGCATTACTCAAGTGTGAGTTTCTCACAGACAGTGTCAAAATCTTGATGCTTCTGTGGGTCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations