Genomic Feature

nuz2

ID
ZDB-ALT-170726-2
Name
nuz2
Synonyms
  • nuz101 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Detrich Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 1: 26669483 - 26669487 (GRCz11) (1) Details
Nucleotide change
AGATG/-
Variant Notes
The deleted sequence is: AGATG.
Deletion of 5 bp from position 2187 to 2192 in REFSEQ: accession XM_700557.7
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted from position 2187 to 2192 in RefSeq:XM_700557.7 in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
GACAGAGATCTTTTGAAGAAACGAAAAGCAGAGGCAGAAGAAAAAGCAACCAACCAGTGGGTTTATGGGTAAAGATAGTGTTAAACGAGGCCAATAAAAGAACTGGAAGGGCTACTGAGCCATGATTATTTACTTTTCAATTCATATCACATTGTGATACTGTGATGCACCATGCATATATGTGGTGTAGTCATTCAAATAATGTCTCCTAACATTGACCGCAGGGCACAGAGCATTAAAAGAGTCAAAAAGAGGACCACTACTGGCACTCCTGGAAGGAAAGGTCGACCAAGAAAAGAACCAATAGTTATTGCAGAAGACCTTGGTCTGGCTCAGGAAGTGGATCCTTCTCCCATCACAATTCCTGTCACAGAACCTGAATTGCCCACAATAGCAGAGATAGAGCCTTTGCAACCAGTTGAGCCACAACAAGAACTGGTGCCTGAAGAAGCAATAAGTGAAAAACCTCAAGAGGAGTTTTTGATTGAGGATCTGGGGCC
AGATG/- AGGAGGAAGATATGCCTCAAAAACACCTGGTTATCGATACAGGTATTTGCTGAAACGTCTTGTTCATGAATGATCTCCAATAATTTCTGGGTGATTCACATCAGAACAAATGATTGTCCATTGTGTATTTTTAGGAGACGACGAGAAGCCATATAATGATGTGCCTGAACAGAGCTCAATTGCAATTCCAATGTTTGCTCCAGCACCTGATTCTTCTCAACCAGATAACCTAAGCCTTACTGAAAATTTACTTTTCTGAGCACCTCCTTACTATGGAAACAATAGGATTGTGGCTAACTCATTTAATACATTTTATCTCAAGGGATTTTAAAACCTGAAACAATAACAAATGTATATTTATTCAAATCCTTAATGTTTTCATGTACATATGCCAATCGTTATTACTTCCAGTCAAATACAAACATTAACTAGATATATTAAGAAAGAATTGTTTGTTAGTTGTTACATTAAGGTACTTTTGTGCCCCCTAGTGATTGTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations