Genomic Feature

sbu29

ID
ZDB-ALT-121106-2
Name
sbu29
Synonyms
  • rest (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Sirotkin Lab
Current Source
Other Pages
Notes
Comment Citation
The sbu 29 allele has a 7 bp deletion that produces a frameshift upstream of  ... ZFIN Staff
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 14: 52428167 - 52428173 (GRCz11) (1) Details
Nucleotide change
GCTGTCG/-
Variant Notes
The sbu 29 allele has a 7 bp deletion that produces a frameshift upstream of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TCCTCGCCCTCTTTAGTGTGGTGTTTGAGGTGCGCCATGTAGTGGTCGAAGCGGTTTGTGTTGTAGCCGCAGCGCTCGCAGCGGATCACGCCTTTAGAGTTGCTCTCTGCGCTCTCAGCGTTGGGTACGGAGGTCTGCGGTCCTGCATCAGCGCTCAGATCCTCATCAGAATCTCCACCGTTCACCACCAGCATCTTCTTGGCTCCGTGCGTGCGTATGTGCACTATAAACTCCTGCTCGTTCTCACCCTGATACTGGCAGGGTTTGCAGAAGAAAGGTTTTTTCTTCTTTTTGCTGGATTCCAGGATGGCGAGCGTCGTTCGCTTTTGTTCTGCCGATGCAGCATTTTCGGTGCTTTCCGTCTGGTTTGGTGGACGTCCAACTCGCACGATTTCTATCTCCTCCAGCACTGGCTCTGGCTGTATATGTGATGCTTGTTGTGTGTAGAGATCTTCAGAGGTGTCCATGCTGTATCTCACGACGGCGTCGTCGTCTTCTTC
GCTGTCG/- GAGTAGCTGCTGCAGGCCACGGTCTGGAGCTCCATCATCTGCTTCCCCTCAGTGCTGTATTCTGATGCAGACGCCTCCGCGGACACCACCACATTCGCCAGCATCACCAGCTGAGGAGCAGACACCTCGTCATGGTGCAGATCCGGCAGGAAGATCCCAGAGGCAGTGGGAAACACCGGCTGAGACATGCTGGACCACTGAAACACACACACACACACACACAAAGGTTATTTTAGTAAATGAAAACTAAAACTGTTAGTCAAAATACATGTTCCTTAACTTATAAAAAGTATCTGAATAAATGTAAAACTAATAAAATTAAACAACTTAAAATAAAAAATATTAATCGCCTGAGGCACGCACACACACACACACTATTGGTCAAAATCTGGTCAAACCCCCCAAAAAAATTGATCTTTAACTGAAATGGAATAAAAAATTCAGAATAAATGAAAAACTAACACTAAAACTGAATAAGAGTCACTGAAAACCCCAATAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations