Transcript

nr1d4b-201

ID
ZDB-TSCRIPT-160112-83
Name
nr1d4b-201
Previous Names
  • nr1d4b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062518 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062518|OTTDARG00000041611| nr1d4b|OTTDARP00000048875 nr1d4b-002 LG_ CT573157.15 Danio rerio protein_coding NOVEL, 1060 bp
CCTTAATGAGTCAGCATCTATGGACATCGGCTGTACAACA
CCCACCGAGACCCCTAGCAGCCCTGAGGACGGCCAATCAG
AAGAGTCCATCGGCGTGATCTCGCAGGCGTATCGTAACAT
CTTCGTGAACGGCGAAAAGCTGCAAGTTAAAGTTGACCAA
GAAAACAACGTCAATAACAACAACAATCCATCTTCCTTCC
GGCACCATCCCATGCAAGAGTCCGGCTACGTCCAGTCTCA
CCCTCAGCCGAATATCTCCGCACAAGAACATTCAGTCCAT
TCCACGACCAGCTGCCTCGCCCAATCCAGATGTCCGGTCG
CCAACCAAAACAACAAACCCACATCTCAAGTTTTGGACAA
CGGTCACTATAACTTCCCACAGTCCTCAAGTCCCAGCCAG
GGAACAACACCTACTCAAAGCTATCCCACTAAACACAACA
GCTATTCCACTCAGACGCAGTCTTGTCCATGGAGACTGAG
CCCTGGTGCTAAAGTTCTGGTAGCCAGTCACTCCAGCCAG
CAGGTCTGGGAGAGTTTCTCGCAGTGCTTCACTCCCGCTG
TTAAAGAAGTGGTTGAATTTGCCAAGAGCATACCTGGGTT
TCAGGCCCTGAGTCAACATGATCAGGTCATGCTGCTGAAG
GCGGGAACCTTTCAGGTTCTGATGGTGAGATTCTGCTCGC
TGTTCAATGCTAAGGAACGCACTGTAACATTCCTGAACGG
TCAAACGTACCCGTTGTCATACCTGCGAGTGCTGGGCATG
GGAAACCTCCTGGATGCCATGTTTGAGTTCAGCGAGAAGC
TGGGCAGCATGGGTCTGGAGGCCGACGAGATGGCCCTCTT
CATGGCTGTGGTGCTGGTTTCTGCAGATCGCTCAGGTATA
TCAGACATGGGGGCCGTGGAGCAGCTCCAGGAGGATTTAA
TAGGAGCTCTTCGGGCTCTCATCACCCGCAGAAGGCCAGA
GGACAGCTCGCTCTTCCCCAAACTCCTGCTGCGTCTGCCC
GACCTGCGAACCCTCAACAACCAGCACTCCGAGAAGCTCC
TCGCTTTTCACATCGACCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations