Transcript

nr1d4b-202

ID
ZDB-TSCRIPT-131113-4756
Name
nr1d4b-202
Previous Names
  • nr1d4b-001
  • ch73-1m18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059993 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059993|OTTDARG00000041611|ZDB-GENE-080403-6 nr1d4b|OTTDARP00000046468 nr1d4b-001 LG_ CT573157.15 Danio rerio protein_coding NOVEL, 2482 bp
TGGGAAGCACAGAGGGCGTGTGAAACAGAGCCACAATCCT
TGGCACACAATAACACAAACAATTTTAAAGGGCAAATAAA
GGAGGGGGAGCTACTGGGGGAAAGGCTCAGTCACATTTCT
AAGACACCTGAAAACGTGTTTGCTGAGTGTGTCAGTGATG
CTTGTGCTGGTCTTAAACTAGTTGCTCAGATCTGCCTTGA
TGATGATGATGATGCCCGGACATCCGCTCTCTTCACCATA
ATAACAGTTTAAGGACAGATTTCAGAGAGTGAGGATCGGC
ACAGTGCCCTGCTTATACCTGAACAGCATCTGACTTTCTG
AATTTTGAGTTTGCTTTAATGCACGTTGAGTTTTCGGGAT
TTGAAACACTCTGAACATCACTCAAACCACCTGCTTTACC
TCAAGAAGCATCGGGAACGCGCATTATGGACAGTCCAGGT
GGAAGTGTGATCCTCTATGCAGGATCGACGGGAAGTGCCA
GTCCCAGCCCAGGAAGTCCATCCAGCGGCTATCAGACCCA
ATCTCCATCCTCTCAGCCCTCGTCCCCAGAGGAGGTGTCC
TTCACTGAGCTCGGAGCCCTTAAAAAGCATTCATCTGGAG
GCAATGGGGGAAACAAATTGGTCTTCCAGTTTCCAGAAGT
AAGCAGTGCTAACACGGTCAACGCGGTTACGCCAACCGTA
ACTTCATCAGGACAAAACTCCTACTCGCACCCAATGGTTG
GCAGACGACCCACCGGGTTCACGGGAACATTTACCAAAAC
TGGAGGTATGGTGTTGCTTTGCAAAGTATGCGGGGATATT
GCATCAGGATTTCACTACGGTGTCCATGCGTGTGAGGGAT
GCAAGGGCTTCTTCCGCCGTAGCATCCAGCAGAACATCCA
TTATAAGATGTGTGTGAAGAACGAAAACTGTCTGATCATG
AGGATGAACCGCAATCGCTGCCAGCACTGTCGCTTTAAGA
AGTGCCTCTCCGTCGGCATGTCCAGAGATGCTGTGCGATT
TGGACGCATTCCGAAGCGTGAGAAACAGCGGCTGCTAGAC
GAAATGCAGAGCTACATGAACAGCCTTAATGAGTCAGCAT
CTATGGACATCGGCTGTACAACACCCACCGAGACCCCTAG
CAGCCCTGAGGACGGCCAATCAGAAGAGTCCATCGGCGTG
ATCTCGCAGGCGTATCGTAACATCTTCGTGAACGGCGAAA
AGCTGCAAGTTAAAGTTGACCAAGAAAACAACGTCAATAA
CAACAACAATCCATCTTCCTTCCGGCACCATCCCATGCAA
GAGTCCGGCTACGTCCAGTCTCACCCTCAGCCGAATATCT
CCGCACAAGAACATTCAGTCCATTCCACGACCAGCTGCCT
CGCCCAATCCAGATGTCCGGTCGCCAACCAAAACAACAAA
CCCACATCTCAAGTTTTGGACAACGGTCACTATAACTTCC
CACAGTCCTCAAGTCCCAGCCAGGGAACAACACCTACTCA
AAGCTATCCCACTAAACACAACAGCTATTCCACTCAGACG
CAGTCTTGTCCATGGAGACTGAGCCCTGGTGCTAAAGTTC
TGGCCTGTCCTCTGAACGCATGTCCCGTTTCCTCAGCCAG
TCACTCCAGCCAGCAGGTCTGGGAGAGTTTCTCGCAGTGC
TTCACTCCCGCTGTTAAAGAAGTGGTTGAATTTGCCAAGA
GCATACCTGGGTTTCAGGCCCTGAGTCAACATGATCAGGT
CATGCTGCTGAAGGCGGGAACCTTTCAGGTTCTGATGGTG
AGATTCTGCTCGCTGTTCAATGCTAAGGAACGCACTGTAA
CATTCCTGAACGGTCAAACGTACCCGTTGTCATACCTGCG
AGTGCTGGGCATGGGAAACCTCCTGGATGCCATGTTTGAG
TTCAGCGAGAAGCTGGGCAGCATGGGTCTGGAGGCCGACG
AGATGGCCCTCTTCATGGCTGTGGTGCTGGTTTCTGCAGA
TCGCTCAGGTATATCAGACATGGGGGCCGTGGAGCAGCTC
CAGGAGGATTTAATAGGAGCTCTTCGGGCTCTCATCACCC
GCAGAAGGCCAGAGGACAGCTCGCTCTTCCCCAAACTCCT
GCTGCGTCTGCCCGACCTGCGAACCCTCAACAACCAGCAC
TCCGAGAAGCTCCTCGCTTTTCACATCGACCCCTGAACAA
CACACAGAGACACAGAAATCAGGGTGCTTTTCTTGTACAA
ACAAAGCCATGCAGAATTATTCAGGAGGACTTTGATCAGC
GCTTTGATGAAATGGACATTTTTCCAGATTTATGAAGAAA
CATGGAGCTGATGCTGGACATTTGGACTCATCTTTCAGAC
ATTTGAGAAGAGATTATCAGGACATTATCGGGACGTTATG
AATATTGTTCTCACTCCAGATGCTATGCATTGTTATTATT
ATGATTGTTCAACACATTGTCAGATACAGTTTAAGTCAGA
ATTATTCGCCTTCCTATTTTTTTTCAAATATTTCCAAAAG
AT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations