Transcript

syn2b-201

ID
ZDB-TSCRIPT-160112-408
Name
syn2b-201
Previous Names
  • syn2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062541 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062541|OTTDARG00000043184| syn2b|OTTDARP00000048895 syn2b-001 LG_1 none CABZ01061872.1,CABZ01061873.1,FQ311892.7 Danio rerio protein_coding KNOWN, 2348 bp
TGGCATTGCATTGGAGCTGTCAGTGCATGAAGACGGAGAA
ATTCAGCAGCAGCATCAGCACACAGTCTTAAAGCGGAGAT
TCCTGGAAAGCCAGAGCTGATTTTCCCCAGTCGCTGACGC
TCACCGTTGAAGATCTGAGAGTTTAACCTTCACAGCCATG
AACTTCCTGCGTCGTCGTCTCTCTGACAGCAGCTTCATCG
CTAATCTGCCCAATGGCTACATGTCGGACCTCCAGCGTCC
GGACCCGCCGCCGCCCCCTCCAGCCGACGCCAAACCTCCA
TCCGGATCCCCTGCCGCCCCATTGGCCCCTGCAGAAAACA
GGTCTCCGTCTTCATCTCCGGCTCCAGAGCGGCGTCCGCA
GCCGGCTCCATCCAGCGGCTCCGGCTTCTTCAGCTCCATC
ACTAACGTAGTCAAGCAGACGGCGGCATCTGCGGGACTCG
TGGAGCAAAGCCCTGCCACCGCTTCCCGGAAGTTCAAGAT
CCTGCTGGTCATCGACGAACCCCAGAATGATTGGACAAAG
CTTTTTCGTGGGAAGAAGGTGCAAGGAGATTATGACATCA
AAGTGGAGCAGGCTGAGTTCAGTGAGATTAATCTGGTGGC
TCATGCTAACGGCACGTGCAGTGTGGACATGCAGGTCATC
AGAAACGGCACCAAAGTGGTCCGCTCCTTCAAGCCTGATT
TTGTCCTGGTTCGACAGCATGCCTACAGTATGGCACAGAA
TGAAGACTTCAGGAACATCATCATCGGCTTACAGTACGCC
GGCATTCCCAGCGTCAACTCACTGGAGTCCATCTACAACC
TCTGTGACAAACCCTGGGCTTTCGCTCAGCTGATCAGCGT
CTACAAGAAAATGGGTCCAGAAAAGTTCCCTCTGGTTGAT
CAGACCTTTTACTCCAACTACAGGGACATGATCTCGATGC
CAACATTCCCAGTGGTGGTGAAGATTGGACATGCTCATTC
TGGGATGGGGAAGGTGAAGGTTGACAATCACAGTGATTTC
CAGGACATTGCGAGCGTTGTGGCCATCACTCAGACATACA
CCACCACTGAGCCTTTCATTGATGCCAAATACGACATCAG
GGTGCAGAAGATCGGCTTTGATTATAAAGCCTACATGAGA
ACATCCATCTCAGGCAACTGGAAATCAAACACTGGATCTG
CCATGCTGGAGCAAGTAGCCATGACTGACAAGTATAAGCT
GTGGGTGGACACCTGTGCAGATGTGTTCGGAGGACTGGAA
ATCTGCGCCGTTAAAGCCATTCATGGAAAAGACGGGAAGG
ATTATATCACTGAGGTGGTGGGCTCCTCGATGCCTCTGAT
TGGTGAACATCAGATGGAGGACCGTCAGCTGATCACCGCC
ATCGTTTTGGCCAAAATGAACCACGAATCCAGCCGTATAT
CAGTGTGTGCCCAACAGAGACCTGCAGCCACCGTACAGCC
TGCACAGAGTCCTGCCTTAAAAGAAAGCCTGCCCGAGCCC
ATCAAGACCCCGGGTCAGCGTCCCCCTCCTCAAGGGGGGG
CAGTGAAACCCCAAGAGCCACAACCTAAGAGTCAAGAACC
TACACCTGAGCCAATCCCTGCCCAGGAACCTGTGCCCAAA
GCAGGCCCAACCCCAACTCTGCCACCCACCACGCAGCAGC
CCAAACCCCAAACCCAAGCGGCACCTGAACCCACTCCAGG
GAAGCCAACGGATCTGCCCCCCAAACCCCAACCTCCCAAA
CCTCTTCCCCCGAAGCCTGTGCCTCCTGTTCGGAGAAACT
CCAAACCTCAGATCCAACCAAAACCCCAAACCCCCCCTCC
CGCTAAAGCTCTTCTGAAAGCAGACTCAGATCAGGATCCT
GGTCAGATCAAGCCAGATTCAGTCCCTGCTCAAGAACAGT
CCCCCGCCAGAGTTCCCATTAAACCCCCGTCACCAGCTAA
ACCTCAGCTCCAGCCTAAACCAGTGCTCAGAGAGCAAGCC
AAACCTGAGGCTCGAGCTCAGCCTGCCGCCCCATCTGAAG
CTGCATCAGCCCCTGTTAGAGCCACTCCAGCCCCTGCCCC
AGCTCCAGCTCCAGCCCAACCTCCTGTGGAGGAACAGCCG
GCACCCCAGCAGAAGTCATCCCATCCTCTCTTGAACAAGT
CCCAGTCCCTGACCAACGCCTTTAATGCCTTCGGCGACAC
CTTCCGCTCCAGCAACGAGGACGAAGCAAAGGCAGAGACC
ATCCGAAACTTGCGAAAGTCTTTTGCAAGCCTGTTCTCTG
ACTAATGGCCAAATCCCAAAACCACTGAGGGTGGCCAGGG
ACTCGTCCGACAGATATGCATCCTGGTCTGAGGTTAACTC
CATGTAGCCGTGTACATTCAACCTCTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations