Transcript

ltv1-002

ID
ZDB-TSCRIPT-141209-352
Name
ltv1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052579 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052579|OTTDARG00000036910|ZDB-GENE-040712-1 ltv1|no_translation ltv1-002 LG_ FP017162.13 Danio rerio protein_coding KNOWN, 748 bp
GTAGTTTTCTTGTGTTTTTGACCCCAGGGGTGGTGGTGGT
GGTGGTGAGGATGATGATGATGATGAATGGGAGGACACAG
ATGATGATGATGGTGAAGAACAGGATTTTGATTCAGAGGC
CGGTCTGTCAGATGATGAGGAAGGCAGACGAAGAGAGTTC
ATGTTTGCTGATTGCGAGACCAAGACTCGATTTACAGAGT
ATTCACTCACATCCTCTGTCATGAGGAGAAACGAGCAGCT
CACACTCCTGGACGATCGCTTTGATGAGTTTTACAAGCAG
TTTGATGATGATGAGATCGGAGCGCTGGATAATGCAGAGC
TGGAGGGATACATTGAGCCGGACAGTGCTCGGCTGGAGGA
GGTCATCAAAGACTACTTCATACAGAAAGAGAAAGACTGT
CAGAAGCCAGATCAGCTGGGGCCTGCAGAGCTGCCATCGG
TGAGAGAGGAAGATGAGGAGGATGAAGATGCAGATGAAGA
GCTGGAGACTGAGAGGATGGTGATCGAGCCACCTGCAGAG
CGCTGGGACTGTGAGACCATCATCAGCACATACTCCAACC
TCTACAACAGGCCCAAACTGATCCAGGACTCTCCGAAGCC
CAAGCAGATCCGAGTGTCCAGCAAGTCTGGGATTCCTCTG
GACGTCCTGCCGAAACGAGGCCTGACAGTCAAACAGGTGG
AGCGGATGGAAAGGATAAACGACTCCGATCTTCCCAGAGT
CTCCACACAGCCGCGCTCACGGGACGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations