Transcript

ltv1-201

ID
ZDB-TSCRIPT-141209-2798
Name
ltv1-201
Previous Names
  • ltv1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052578 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052578|OTTDARG00000036910|ZDB-GENE-040712-1 ltv1|OTTDARP00000041332 ltv1-001 LG_ FP017162.13 Danio rerio protein_coding KNOWN, 2129 bp
AAAATGGCCGCTTCTCCTCCATGTGTTTGAATGTGACAGA
AGGATCTTTATTATTTAATTCTTCGTTGTTCACGCTTAAC
AACATATAAAATATTATTCAGACCAAAAACGCAAACGTAT
TGATAATACACTAACTTGTAAAAATGCCGCACAGAAAGAA
GAAATCCTTCATCAACAAGAAGAACGCTGTGTCTTTCCAC
CTGGTTCACAGAAGTCAGAAAGATCCTCTGGCCGCAGATG
AAACTGCCCCTCAACATGTCCTTCTGCCCACCGTCAGGGT
GGAGTTGGAGAAGAGGAAAGAGGAACAGCGCAACTTTGGC
GTGTTTTTCGACGATGATTACGATTACCTGCAGCACCTGA
GAGAGTCGACTCAGACCGCTGAGCTGATTTCTGCTCCACG
TGTTCGCAGAGATGCTCGACTGAAGCCTGCAGATGATGAA
GAGCACATGGAGGAAGAGGACGGCAGCGTCCCTGAAGCCT
CCATCAAACTGCCCTCGTCTGTGTTCGCATCTGAGTTTGA
AGAGGAAGTGGGTTTATTAAACAAAGCAGCTCCTATTTCA
GGGCCGCGGTTGGACATGGATCCTGACATCGTGGCTGCTC
TGGATGAGGACTTTGATTTTGACGACCCAGAGAACATGCT
GGAAGACGACTTCATAATCAAGGCCAATGACGTCATGGGG
GGTGGTGGTGGTGGTGGTGAGGATGATGATGATGATGAAT
GGGAGGACACAGATGATGATGATGGTGAAGAACAGGATTT
TGATTCAGAGGCCGGTCTGTCAGATGATGAGGAAGGCAGA
CGAAGAGAGTTCATGTTTGCTGATTGCGAGACCAAGACTC
GATTTACAGAGTATTCACTCACATCCTCTGTCATGAGGAG
AAACGAGCAGCTCACACTCCTGGACGATCGCTTTGATGAG
TTTTACAAGCAGTTTGATGATGATGAGATCGGAGCGCTGG
ATAATGCAGAGCTGGAGGGATACATTGAGCCGGACAGTGC
TCGGCTGGAGGAGGTCATCAAAGACTACTTCATACAGAAA
GAGAAAGACTGTCAGAAGCCAGATCAGCTGGGGCCTGCAG
AGCTGCCATCGGTGAGAGAGGAAGATGAGGAGGATGAAGA
TGCAGATGAAGAGCTGGAGACTGAGAGGATGGTGATCGAG
CCACCTGCAGAGCGCTGGGACTGTGAGACCATCATCAGCA
CATACTCCAACCTCTACAACAGGCCCAAACTGATCCAGGA
CTCTCCGAAGCCCAAGCAGATCCGAGTGTCCAGCAAGTCT
GGGATTCCTCTGGACGTCCTGCCGAAACGAGGCCTGACAG
TCAAACAGGTGGAGCGGATGGAAAGGATAAACGACTCCGA
TCTTCCCAGAGTCTCCACACAGCCGCGCTCACGGGACGAG
AACACAGAGGAGAGGAAAGCCAGAAAACAGGCTATCAAGA
GCGAGAGGAAGGAGAGGAGGACCGAGAAGAAAGCAAACAA
ACTGGCGTTCAAACAGGAGAAGCAGATGCAGGAGAAACAG
ATGGTTCATTTAAGAGCAAACGTTCAGGGCATGAAGCTTT
CATAGAGACTACAGGACCTTAGTGAAGACACTTCTGTTCA
CAGGCCACAAGGGTAACGATGACATCACTCACTGTACCTG
TCCAGGACTACTATGTTTCTTGAGGCAGTTCTAAAAAACA
TTCTCTAACAGTGTTGCCATGGAAACATCGGAATGAATGG
AACCTATAGAGATGGTTCCGTTTATTTGGTTCTACTTCAG
TTTGACTGTTTAATGGTAAACAGTTAAACGTTCGCTATTA
GTGTTTGTATAATATGTAATTATTATTCACATCCTACAGT
TTATTTCAACCAATTATTAAAAAAAAGAATCAAGTATAAT
TTTTTACAAAGGAATCCCACTTTTATTTAAACACTCTTCA
CAAAAAACCTCTCCAGCATTGGCAGATTTATTCATCAGCT
TAGGTCAGACTGTATGGCTTTAGTTTATTAACATCATGAC
ACGCATCTGTTCTTCAAAGTTCATGGATTTATACAATAAA
ACATCTTTGACCTGAGATAACTTCCTGTTATTGTCATGGA
GTGCACATGTGATGCTACATAGTGATCTGCTTGCATCAAG
CTGGAAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations