Transcript

nr2c2-201

ID
ZDB-TSCRIPT-141209-2576
Name
nr2c2-201
Previous Names
  • ottdart00000035153
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035153 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035153|OTTDARG00000026466|ZDB-GENE-080403-8 nr2c2|OTTDARP00000028275 nr2c2-001 LG_ CR385042.30 Danio rerio protein_coding KNOWN, 4077 bp
CGTGCCCGCGCAACCGCGAACGCGCCCGAGAGGAAGAAAA
ACTCTCGCACGCTGGCAAACGGGGTCACGAACTATGACCT
TTCACTGGAGTAAAACAATAACAAATAATGTGCAATAAAC
CCGAGAGCGAAAACCCCGCGGCCGTGCGTTTGACAGGAGG
AGGTATCATTTTCAGATGCAGAGCTCGGCCAATCAGATGC
TTGTAATGACTTCACATTACCATGACAACCAATGTGGAGC
TGCTGGCTCAGCAGATATTGACCACTGAGCAGCTTTCAGA
GGTTCAGTTGTCTCCGTCAGGCAGTTCAGTGATGAGCGGC
TCTCCTCAGCGCATTCAGATCATCTCCACCGAGCCCTCGG
TCACCAGCCCACAGAGAATACAGATCGTCACAGAGCAGCA
GACGGGGCAGAAGATCCAGATAGTGACGGCTCTGGACTCC
TCTGTGCCCAAGCAGCAGTTCCTCCTGGCCTCTCCTGATG
GCTCTCCAGCGGGTAAAGTCCTGCTGGCGTCCCCAGAGAG
CTCCAGCGCCAAACAGCTCATCTTCGCCACTGCCGACAGC
CTGGTACCCGGCAGAATACAGTTTGTGACTGATGCCGTGT
CCGTGGAGAGGCTTCTGGGTAAAGGCACAGACCTCAGCCG
AGTTCAGCCAATTGAATACTGTGTGGTGTGTGGAGATAAA
GCCTCAGGGAGGCATTATGGAGCTGTGAGCTGTGAGGGCT
GTAAGGGTTTCTTCAAGCGGAGCGTGCGCAAGAGTCTGAC
CTACAGCTGCAGGAGTAACCAGGACTGTGTGATCAACAAA
CACCACCGCAACCGCTGCCAGTTCTGCCGGCTCCGCAAGT
GCCTGGAGATGGGCATGAAGATGGAGTCTGTACAAAGTGA
GCGGAAACCCATCGATCTTCCTCGAGAAAAACCTGCGAAC
TGTGCAGCGTCTACAGAGAAAATCTACATCAGGAAAGACC
TGCGCAGTCCGCTTATCGCAACACCCACCTTCATCTCTGA
GAAAGATAGCTCACGGTCCAAGCTGTTGGATTCTGGGATG
CTCGTCAATATCCAGCAACCCTTAATACAGGCTGATGGCA
CATTACTGTTAGCAACAGACAAGACGGAGTCGGGGCAGGG
TGATCTGGGGACACTCGCTAATGTGGTCACATCATTAGCA
AACCTGAACGATTCGCTCAGTAATGGAGAAGCAACAGACG
GGCAGCTGGAGGAGTCGCCCAGTGAAATCACACGTGCCTT
TGACACTCTGGCTAAAGCGCTGAACCCCGGCGAGCTGACG
GAGAGCCAGAGTCTGTCTGAGGTGGACGGAGTGGGCGGAG
CTACAATACAGGTGATCAGCAGAGATCAGATCTCGCCACT
CATAGAGGTGGAGGGACCGCTGCTCACCGACACACATGTC
AGCTTTAAGCTGACGATGCCCAGCCCGATGCCGGAGTATC
TGAATGTACATTATATCTGTGAGTCGGCTTCACGTCTCCT
CTTCCTCTCCATGCACTGGGCGAGATCTATCCCAGCATTC
CTTGCTCTCGGGCAGGAGTGTAACACCGCTCTGGTTCGGG
CCTGCTGGAATGAGCTGTTTATTCTGGGTCTGGCTCAGTG
TGCTCAGATCATGAGTCTGTCCACCATCCTCACCGCCATC
GTCAATCATCTGCAGTCCAGCATCCAGGACGTAGACAAGC
TATCAAGTGAACGCATCAAACTCGTGATGGAGCACATCTG
GAAGCTGCAGGAGTTCTGCAACAGCATGGCGAAGCTGCAG
ACGGACGCTTATGAATACGCATACCTAAAAGCCATCGTGC
TCTTCAGTCCAGATCATCCAGGTTTGAGTAGCTGCAGCCA
GATTGAAAAGTTTCAGGAGAAAGCGCAGATGGAGCTCCAG
GACTATGTGCAGAAGACCTATCCGGATGAAACCTACAGGT
TGGCTCGAATCCTGCTGCGATTACCGGCGTTGCGTTTGAT
GAGTTCCAGCATAACCGAGGAGCTGTTCTTCACCGGCCTC
ATCGGAAACGTACCGATCGACAGCATCATCCCATATATCC
TCAAAATGGAGACTGCAGACTACAACAGCCAAATCACAGC
CCCCTCCGTGTGACCATCGTTTCATGCGATTCCCATCATC
CCTCGCCCCCGAATACATCGCATTATACTGAACCGACCAA
CAAGCTCTACCTCAAGAGGAGCTGCGACAGCGAAAGCCTT
TCTGAAGCGCTACCCGATTGATATTGTGTTGTAGTTTACA
GAGAGAGATGCATTATGGGACTTTGAGTTCCAGGACATTT
GCCTCAAATTAAAGGCCTTTCTTATTTTGTAAACTTTAAT
TTAAAGAAAGAGAAACACTTGAGCACTTCGAGATGATTCC
AATGGAAAAATCCCAATTTTTTTTTGAATCGCCCTCGTTA
ATATTCATAATTATCAAAAGCATGAGCATTTTCATAAGGA
GATGTGACTGAATGTATCGGCTGATTACATGATCCAACAA
AGGTATGATTTCATTCAGATTTGTTTCTCTCTCTCTGACC
GTACAGCCATTGAAATGAATGGGAATTTAGTGTTTTTCCT
GCAGCTCTTAATTTATCCGTACTGTCACTCCTGTCGTCAC
GACAATCAGCTTCTGCTCAATATATCCGGCTTTTCCTTTG
CTGTATTTATTTCAGCTCTAAAGCGCATACAAATGTAGAT
CTTCGCTTGATTTCCAAAATCACGTATGCTATAGGAGATC
TTCAATCGGTGTCTTTAAAGCATCTTTATCGCTGCTGCAA
TTGTCGTTTTCAAGATGTAATATATCCATAAACATGATGC
ACTTAGGTTCCTAACATGTTTTTATTCGCAGATCTGCGCA
CTTAAGTTACATTTGTACATTTTAATTTGTCTTTTTTTTA
AGAAAGATGTCTCGTTTTGTCCCAAATGTGATGCATTGAC
ATGCACTTATTTAACATGCTGTTTCTGAAACAGAAATGTT
GACCCAGGCTGTATTTGTTTGGGTTTAAAATCGGTAGACT
CTTCCAGACTATGTTAGCCTGATGCTATTGGTTAGCCACC
TTGTTTGTTTAGGTTCGAACTACCATTAACATTATTATAT
AGGTTGTTACAAGGTGTTTGTAGCTTAATATACAACATTA
ACCCAGATAATATAGCACTGCAAACTATTAAAATGACAAT
AAAAGTCACTTTTTACAACGTTTAAAGATTAAAAGCTAAA
GATTAAGATCCCATAATGCAATTTAAAAGCAGAAATAAAC
CAAACATGAATCACAAAATATGAAAAACTACTAATTTACT
GATGTTTTGTTATTTTTTATAGTGTATAATGTTTATAATG
TGTGTTTTTTTTACTGTTTTAGAGTCATTTCTTCTTGGCC
TCATTAATTATGTCCCAAAAAACAACTTGTTATTGTTTTA
AAAGCACGATGGCCTCATACAAGTATTTATTTTAACATGG
TTTGAACACATTTTTTATTTGATGCCCAATGTTTCTGATC
TGTCAATGACTGGTTTATAGGTGTTGTAAATCTATATTGC
TGTCTGTCTTCATCTGTCTGTGAGACGATAAGAAAAGCTG
TGCATGAAGAGCTCATCAATTTGATTCTGATGTGGAGTTT
AAATATTGTGGCTTGAGGAAATAATATATATATATATATT
TACAGTGCATTCAGAAAGTACCCATTCGCATTCATTCTTG
ACCATTTTGTTTATTCAGAAGTGCATATACGTTTAATTCA
TGCTTGATTACAGAGCTGAAACCAGATTTGTGATAACTTT
TGCAGATGTATTAAAATGCAAACACTGACATGTGACAATT
CTGTTTTTAAGAAGCACAAATGACCATTTTTTCATAGGGG
TGAATGAAAATGACTGGTTGTCTATAGTGTTCTCATTTTG
TGCAATATAGCATAAAAACAAAATTTACACTCACCGGCCA
CTTTATTAGGTACACCTTACTAGTACCAGGTGTGACCCCC
TTTTACTTTCAGAACTGCCTTAATCTTTCATGGCGTAGAT
TCAACAAGCTACTGGAAACATTGGACGTGTTGTGTGTTCA
GAGATGCTCTTCTGCAGAGCTCGGTTGTAACGAGTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations