Transcript

nr2c2-002

ID
ZDB-TSCRIPT-141209-138
Name
nr2c2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035154 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035154|OTTDARG00000026466|ZDB-GENE-080403-8 nr2c2|no_translation nr2c2-002 LG_ CR385042.30 Danio rerio protein_coding KNOWN, 513 bp
GTGCCCGCGCAACCGCGAACGCGCCCGAGAGGAAGAAAAA
CTCTCGCACGCTGGCAAACGGGGTCACGAACTATGACCTT
TCACTGGAGTAAAACAATAACAAATAATGTGCAATAAACC
CGAGAGCGAAAACCCCGCGGCCGTGCGTTTGACAGGAGGA
GGTATCATTTTCAGATGCAGAGCTCGGCCAATCAGATGCT
TGTAATGACTTCACATTACCATGACAACCAATGTGGAGCT
GCTGGCTCAGCAGATATTGACCACTGAGCAGCTTTCAGAG
GTCAGTGGTGATGCGAGACATTAAGGGTTCATTCAGACGC
AGCAGTAGCGGTGTGTCCTCTATGCAGTCGGTTGCAGTAA
ACGGATCCATCTATGTGCTGGAAACACTGGTTGTAGTCAG
AAGACTCCTAATCAGCCAAAATATTAAGTCTACCTTTAAT
TTTATTTGTAAGATCAGGCTTATTCGAGGTCATGCTGTGT
GTTCTTACTGTGGGGATAAATAAACAGGATTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations