Transcript

ottdart00000032801

ID
ZDB-TSCRIPT-141209-128
Name
ottdart00000032801
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032801 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032801|OTTDARG00000024989|ZDB-GENE-040426-847 hdac3|OTTDARP00000026535 hdac3-001 LG_ BX000526.8 Danio rerio protein_coding KNOWN, 2135 bp
TCCTTCGCAATGCCACTCCACACCCCAGTTCAGTTGGTGG
CGGTAAGGCACCAAAAGTTGGATTTGACACCATCAAGAAG
AAGAAGAAGCGGAAGTGATTTTTTTGCTGTTTTAGAGAAG
ATGGCGGCGGCGTTGAACAGAAATTAGAATAATTAAAACA
TTTTTGTTTTCTCGTGCTAGAAATAACTGCTTTTATTTAC
ACTCTGTTGCAACATGACCAATCGAACTGCGTACTTCTAT
GACCCAGACGTTGGGAACTTTCACTATGGTGCTGGGCATC
CAATGAAACCTCATAGACTATCACTCACACATAGTCTTGT
ACTTCATTATGGACTATACAAGAAGATGATGGTTTTCAAA
CCCTACAAGGCATCCCAGCATGACATGTGCAGGTTCCACT
CTGAGGATTACATAGACTTTCTGCAGAAGGTCAGTCCAAA
CAACATGCAGGGCTTCACAAAGAGTCTCAACACTTTCAAT
GTAGGAGATGACTGTCCTGTCTTTCCAGGTCTGTTTGAGT
TTTGTTCAAGATACACCGGTGCCTCATTACAAGGAGCTAC
TCAGTTAAACCACAAGATTTGTGACATTGCTATAAACTGG
GCGGGAGGTTTACATCATGCAAAAAAGTTTGAGGCATCTG
GATTTTGTTATGTGAACGACATTGTCATCAGTATTCTTGA
ACTCCTGAAGTATCATCCACGTGTGCTCTACATTGACATT
GATATTCATCATGGGGATGGTGTACAGGAAGCATTTTATC
TCACAGACAGGGTCATGACAGTGTCCTTCCACAAATATGG
GAACTATTTTTTCCCGGGAACTGGTGATATGTATGAAGTT
GGGGCTGAGAGCGGCCGCTACTACTGCTTAAATGTCCCTC
TGCGAGATGGCATTGATGACCAGAGTTACAGACAACTATT
TCAGCCAGTTATCAAGCAGGTGGTAGACTTTTATCAGCCA
ACCTGTATTGTTCTTCAGTGTGGAGCAGATTCTTTGGGAT
GTGATCGATTAGGATGCTTTAATCTCAGCATACGAGGACA
TGGAGAATGTGTGGAGTTTGTGAAGGGCTTCAAAATTCCG
CTGCTTGTTCTGGGTGGAGGAGGGTACACAGTGAGGAATG
TGGCTAGATGTTGGACATTTGAAACATCATTGCTTGTTGA
GGAGTCAATTAGTGATGAACTTCCATATAGTGAATACTTT
GAATATTTTGCTCCAGACTTCACACTTCATCCAGATGTCA
GCACAAGGATAGAAAACCAAAATTCTAGACAATATTTGGA
ACAAATTCGTCAAACTGTGTTTGAAAACTTGAAGATGTTG
AATCATGCACCAAGTGTCCAGATCCACGACGTTCCCTCTG
ATTTGCTGAGCTACGAGCGACCAGACGAGGCTGATCCTGA
AGAGAGAGGATCAGAAGAGAACTTTTCTAGACCTGAAGCT
GCGAATGAATTTTATGATGGTGACCATGATCATGATAAAG
AAAGTGATGTGGAGATCTGAAGACTTTTTTGTGCAGTGTA
CCTGTCTTTGGTCTTCAGCCATGAAGGTGTCCATTCCTTG
CAGTATCTACAGTACTTGACTTTGATGTGTGGGTAAAAGC
CAATCAGTTTTTTAACATGTCGAAATTGTGTAGTTCACCA
TATGTAGGTCTTTATATTGTATTTTTCTGTTTATCAAATT
TTAAGTAAAAAAGGGAACTTTACAATGAGTCCTGCAAGCA
GCTTCTGCTGCATTTGTATTCAGAGGGTTCAACAATAATG
TGATGAATGATGGCTTTGTGTGCCTAATATCCAAGTGTTT
TGATTTAGAGAAAATAAAATCTATTTGAAATGAGCCTTTC
TATCTAAAACATCTATTTACACAGTCTGACCCTAAGAACT
GTCTAAAATGTGGCGGATCACCAGTGCTGTTTGTTATTTT
AATTATTTGGCAGCTGTCTTGTTTTGTTGTATTTTGTTAT
AGTATGTCTCATAGTTTGAGTTTTGTATGTTAAGAATATG
ACATGCTGGAGGAAACAACTAGGAGATAAATGTATAATAT
TTTCACAAAAATGTTATTCAAAATTTCATGTCACAAGTCA
CAACATATAACACATTTTTTTGTATTCTCAACTGTAATAA
AAACATTTTACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations