Transcript

ptenb-201

ID
ZDB-TSCRIPT-121213-280
Name
ptenb-201
Previous Names
  • ptenb-002
  • rp71-1g13.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058109 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058109|OTTDARG00000001921|ZDB-GENE-030616-47 ptenb|OTTDARP00000045499 RP71-1G13.4-002 LG_ AL731788.8 Danio rerio protein_coding KNOWN, 1947 bp
TGATGGAAGTTTGAGAGTGTAACAGGCAGTGGAGCAGTGG
AGGATAAGGACAGAACCGGAGGTGTCTCTTACGCCACATT
TAAATATCGAGTTTTTCATTTCTTGGTGGAGGCTGTCACA
TTTTGTTTCATGTGTTGGAACCTGGTCATCGCGGATTGTC
GTAGAGTTTAATGGCTTTTATTTTCTAAGGATGTGTAGAC
GGGCTAGCGCGTTAGCCGTTGAGGCTAGACGGAGCGCGAG
CTGAGTGCGAGCGGGGCTCTGACGACCGATCTTCAAGTGG
AAGCACCGGAGAGGATTTTCTCTCCGCCTTTCCGCTCAAT
CACGGCGGCTTCGGTGCGACCAGAGACTTGTCGTGCACTA
GAGATTCTGCAGTTCCAGACGTGGGAAGTTGCTTATCTTT
TCACCCAGGGCTCGTCTGAGCCGAGGAGGGCATTTTGGAA
GCCGGGCCTGTGGTGGTTTGGAGCGAGGCCCTTGATGAGT
GAGCCACAGCAGACTCCATTCTAGCTAGCTGGGGGACTGC
GAAACGAGCAGAGCATAAAGACGACCGACCGTCCGAAAGC
AACAATACTCTCTCTCACACTAAAAACCCTAAAGACTCCT
GTCACAGCCATGGCTGCGATCATAAAGGAATTTGTCAGTA
GAAATAAAAGGAGATACCAAGAAGACGGGTTCGACTTGGA
CTTGACATACATTTATCCTAACATAATAGCTATGGGTTTC
CCTGCTGAAAGACTGGAGGGTGTATATAGAAACAACATAG
ATGATGTAGTGAGGTTTCTTGATTCAAAGCATAAAGATCA
TTACAAGATATATAACCTATGTGCAGAAAGACATTACGAT
ACTGCCAAATTTAACTGCAGAGTTGCACAGTATCCATTTG
AGGATCACAATCCTCCTCAGCTAGAGCTCATTAAACCTTT
CTGTGAAGATTTGGATAAATGGCTCAGTGAAAATGACAAT
CATGTGGCTGCCATTCACTGCAAAGCTGGAAAGGGAAGAA
CGGGTGTCATGATTTGTGCGTACTTGTTACACCGAGGCAA
ATTCAAAAAAGCACAAGAGGCTCTGGACTTCTACGATGAA
GTTAGGACCAGAGACAAGAAGGGAGTGACTATTCCCAGTC
AGAGGCGATATGTATACTACTATAGCTACCTTCTGAGGAA
TAAGCTGGAGTACAAACCTGTGGCCTTGCTCTTTCACAAG
ATGGTGTTTGAGACAGTGCCTATGTTCAGTGGAGGGACCT
GCAGGGATTCTGCTGTAAAAAGCAAGAGTGAGCAGATTCC
ACATGGGTTCAGAAAAACCAATTGGCATTGGGATCCTCAG
TTTGTGGTGTACCAGCTGAAGGTGAAAATTCACACCTCAA
ACCCAGCGCACACAAGAAGAGAGGAGAAGTACATGTTCTT
CGAATTTCCTCAACCACTGCCTGTGTGTGGGGACATCAAG
GTGGAGTTCTTCCACAAACAAAACAAGATGATGAAGAAGG
AGAAAATGTTCCACTTCTGGGTGAACACCTTTTTCATCCC
TGGGTCAGAGGAGAGCACAGAGAAAGTGGAAAATGGAGGT
TTAGTGAAGGACCTGGATGGAATACAAACAGCAGAGAGAG
GAGAGAATGACAAAGACTATTTAATTCTTACTTTAAGTAA
GACGGATTTGGATAAAGCGAACAAGGATAAAGCCAACAGA
TACTTCTCTCCCAATTTTAAAGTTAAAATGTTTTTTACGA
AAACAGTGGAGGAACCATCCAACTCAGAGGCCAGCACTTC
TACTTCTGTAACCCCGGATGTTAGCGATAATGAACCGGAC
CATTATCGTTATTCGGACACAACAGACTCAGACCCTGAAA
ATGAACAGTACGATGAAGAACAGATTACTAAAGTTTGAAA
TATTTTTATGGGAAGAAAAAAGTAAACATGCGTAACAGAG
TTGTATAAAGGAGAAAACTTGAATATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations