Transcript

gpnmb-202

ID
ZDB-TSCRIPT-120213-239
Name
gpnmb-202
Previous Names
  • gpnmb-002
  • ch211-155k24.6-002
  • si:ch211-155k24.6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053811 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053811|OTTDARG00000014410|ZDB-GENE-060503-106 gpnmb|OTTDARP00000042287 CH211-155K24.6-002 LG_ BX469899.6 Danio rerio protein_coding KNOWN, 1994 bp
GACAGCAGAAGACAGTTGAGGAGATTGGGATCAACCAGCC
AGGGTGTCGTAGGGGGGCATACAAGGAAAAAGTCCTTGGA
TAGTTCAGTTTTCATAAAATTTTCAACTAATCCACAAATC
GACATGATGCGACTGGAGCTGTTATTTGTGCTGGCCTGGG
CATTTTTTGTTCCTGGAACGAACAGTAAAAAAACATATGG
TGACATGTTCCCTCACAAACATAAGCTTCCTTTTCCATTC
CCAATCCCTGGATGGGAACCGGACACGAACCCTTGGGACG
AATCTCTGTATCCCCCCTTCAAACCGCAGCTGACTCGCAG
ACATGAAAAACCACCAAAGGTGCGTCTAACGAGTGACAGT
CCTGCGATGAATGGCTCGTGCATCTCTTTCACTGCTGCTC
TGGAGTTTCCTCCATGTCAGAAGGAGGACAGCAATGGCAA
CCTGGTGTATGATGAACACTGTGATGACGCCAATGGACAG
CTGCGCTCAGGCTACGTGTTTAACTGGACATCCTGGTTGG
ATGACTATGGCTACGGGAAGTGTACAGACCTAAAGAGATG
TAATGTTTTCCCTGATGGAAAGCCTTTTCCTCAGACTAAT
GACTGGAGGCGCAGAGGTTATGTGTATGTGTGGCACACCA
TGGGTCAGTATTTTGAGACATGTGATGGCTCTTCCTCTCA
TCTGACCCTGAACACCACTAACATGACGTTTGGAGCTGAT
GTGATGGAGGTGATGGTGTATCGTAAACGCGAGCGCAGAA
AGTACAGCCCACTTTCCACAGATAAATCTGTATACTTCAT
TACAGATAAGATTCCACTCTCCGTCAACATTTCCCAGAAG
GAAGCAGCCAGCAGAGCGGACAGAAACATCTTTGTCAGAG
GGTCTGATGTTATTTTCAACGTCCAGCTCCACGACCCCAG
TAACTATCTGAAAACAGCTGATGCGGTGGACTTCATTTGG
GACTTTCGGGATGGCAACCAGTTGGTGACACACAGCAGCG
TGGCAACTCATGCATATGACATGCTTGGAAATGTTACAGT
CAAGCTCCTGGTAGAGGCAGCATTTCGTGTTCCCTGCCCT
CCACCGACTCCAACACCAGTGCACTTTACACAAGCTCACA
CCACAGCAATACCAACTCTTCCTCCTGGCACTCACACATT
TACTAGCAAAATGGAAACTACCAAAGCTCCCGTCATCAGC
AGTGCTTTACCCATGACCACCACTCGAGTTCCTACAACTG
CCATCCCAACAACTGAACCCTTTCAGACTGACTCAGAGGT
TACAGCAACTGCACCTGAGTCCAGCTCCAGCTACAACCAG
CCCACTGCACCGCCGCTGCTCAAACACAAACACTTCCAGG
AGTCAGACTGTTTCCGCCACATGTACGGCTCCTTTGAAGG
AGAGATCATCCTCATTGAACGTCCTCCAGCTCTGCAGAAC
CTGCCGGCCAATCAGATTTTAAAGGTGTCTGCAGACAAAG
TGAGCAACACATCAGTAAACTTCATGGTGACCTGCTCAGG
AAGTGTTCCCTCAGTAGCCTGCACTATAGTGGCCAACTCT
GCCTGTCGGGAGGTTAAGAACATTGTGTGTGAGGACGTGA
CCCCTTACGACGAAGGCTGTAAGATCAGTTTGACGCGCAT
TTTTCAGACGCCCGGCACTTACTGCATCAACATCACGCTG
GGTGTTCCTGGAGGACTCGCTCTCGCCACCACAACCTCAA
TCACCATCGGAAACAGCCCTGATAAGACAGTTCTGTTCTC
AGTGGATGAGGAAAGAAGCTGTTTATTGACCGAAAAGCCA
CAATAGGCTGACCTGAGCTGTCGTAGTCACCAGTTTCTAC
GGGTGCTACTTATTTAATACATCACCTTAGCTGTAAAACT
ATAAAAAATACAAGTGATAGGTGAGTGCAAGGGCGTAGAA
TTGAAATAAATAAAGGGGACATTTGTCCTCACCAATATCC
ACCAATTACTGACATGTCCCTGCCAATTATTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations