Transcript

gpnmb-203

ID
ZDB-TSCRIPT-090929-3687
Name
gpnmb-203
Previous Names
  • gpnmb-001
  • si:ch211-155k24.6-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017210 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017210|OTTDARG00000014410|ZDB-GENE-060503-106 gpnmb|OTTDARP00000014579 CH211-155K24.6-001 LG_ BX469899.6 Danio rerio protein_coding KNOWN, 1973 bp
GCCAGGGTGTCGTAGGGGGGCATACAAGGAAAAAGTCCTT
GGATAGTTCAGTTTTCATAAAATTTTCAACTAATCCACAA
ATCGACATGATGCGACTGGAGCTGTTATTTGTGCTGGCCT
GGGCATTTTTTGTTCCTGGAACGAACAGTAAAAAAACATA
TGGTGACATGTTCCCTCACAAACATAAGCTTCCTTTTCCA
TTCCCAATCCCTGGATGGGAACCGGACACGAACCCTTGGG
ACGAATCTCTGTATCCCCCCTTCAAACCGCAGCTGACTCG
CAGACATGTCCTCTCTCATGACAGAAAAACCACCAAAGGT
GCGTCTAACGAGTGACAGTCCTGCGATGAATGGCTCGTGC
ATCTCTTTCACTGCTGCTCTGGAGTTTCCTCCATGTCAGA
AGGAGGACAGCAATGGCAACCTGGTGTATGATGAACACTG
TGATGACGCCAATGGACAGCTGCGCTCAGGCTACGTGTTT
AACTGGACATCCTGGTTGGATGACTATGGCTACGGGAAGT
GTACAGACCTAAAGAGATGTAATGTTTTCCCTGATGGAAA
GCCTTTTCCTCAGACTAATGACTGGAGGCGCAGAGGTTAT
GTGTATGTGTGGCACACCATGGGTCAGTATTTTGAGACAT
GTGATGGCTCTTCCTCTCATCTGACCCTGAACACCACTAA
CATGACGTTTGGAGCTGATGTGATGGAGGTGATGGTGTAT
CGTAAACGCGAGCGCAGAAAGTACAGCCCACTTTCCACAG
ATAAATCTGTATACTTCATTACAGATAAGATTCCACTCTC
CGTCAACATTTCCCAGAAGGAAGCAGCCAGCAGAGCGGAC
AGAAACATCTTTGTCAGAGGGTCTGATGTTATTTTCAACG
TCCAGCTCCACGACCCCAGTAACTATCTGAAAACAGCTGA
TGCGGTGGACTTCATTTGGGACTTTCGGGATGGCAACCAG
TTGGTGACACACAGCAGCGTGGCAACTCATGCATATGACA
TGCTTGGAAATGTTACAGTCAAGCTCCTGGTAGAGGCAGC
ATTTCGTGTTCCCTGCCCTCCACCGACTCCAACACCAGTG
CACTTTACACAAGCTCACACCACAGCAATACCAACTCTTC
CTCCTGGCACTCACACATTTACTAGCAAAATGGAAACTAC
CAAAGCTCCCGTCATCAGCAGTGCTTTACCCATGACCACC
ACTCGAGTTCCTACAACTGCCATCCCAACAACTGAACCCT
TTCAGACTGACTCAGAGGTTACAGCAACTGCACCTGAGTC
CAGCTCCAGCTACAACCAGCCCACTGCACCGCCGCTGCTC
AAACACAAACACTTCCAGGAGTCAGACTGTTTCCGCCACA
TGTACGGCTCCTTTGAAGGAGAGATCATCCTCATTGAACG
TCCTCCAGCTCTGCAGAACCTGCCGGCCAATCAGATTTTA
AAGGTGTCTGCAGACAAAGTGAGCAACACATCAGTAAACT
TCATGGTGACCTGCTCAGGAAGTGTTCCCTCAGTAGCCTG
CACTATAGTGGCCAACTCTGCCTGTCGGGAGGTTAAGAAC
ATTGTGTGTGAGGACGTGACCCCTTACGACGAAGGCTGTA
AGATCAGTTTGACGCGCATTTTTCAGACGCCCGGCACTTA
CTGCATCAACATCACGCTGGGTGTTCCTGGAGGACTCGCT
CTCGCCACCACAACCTCAATCACCATCGGAAACAGCCCTG
ATAAGACAGTTCTGTTCTCAGTGGATGAGGAAAGAAGCTG
TTTATTGACCGAAAAGCCACAATAGGCTGACCTGAGCTGT
CGTAGTCACCAGTTTCTACGGGTGCTACTTATTTAATACA
TCACCTTAGCTGTAAAACTATAAAAAATACAAGTGATAGG
TGAGTGCAAGGGCGTAGAATTGAAATAAATAAAGGGGACA
TTTGTCCTCACCAATATCCACCAATTACTGACATGTCCCT
GCCAATTATTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations