Transcript

col19a1-202

ID
ZDB-TSCRIPT-110912-826
Name
col19a1-202
Previous Names
  • dkey-180f8.1-001
  • ottdart00000052079
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052079 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052079|OTTDARG00000036546|ZDB-GENE-090312-196 col19a1|OTTDARP00000040924 DKEY-180F8.1-001 LG_none BX323574.13,CT025894.24 Danio rerio protein_coding NOVEL, 1193 bp
ATTCTCACTTTTATTTGCAAGTGCGCTTTGGACCCACAGC
TGCCTAAAATGCGCTAATTAGCAAACAGGATTTTGCTTGT
GCTCTGTGTGTTTACGCTGGAATAATAAACTTTCTCCGCA
AAATGTTTTCAAGGGGCCCTTTCTCATGTGCCAAAGACGA
CATGATTCACTATCTCAGATGGACTGTTTTCCTGTGGATC
GTAAATTCCATTCCTTTTGCTTCAGGAATGGCAGTGAATG
AGAGAATAGATCATACATGTCCACCCCTGAAGCTGGAGGA
TAAATGGCACACCAATGTGAACCTTCACAGAGAATTCACA
GGATTTGATTTAGCTGAGAAGTTTCTCCTCAGAAAAGGCA
CCGTGACGGACAGCGACACGCCGTTGTTTAGACTGGGAAG
TAAACCCCTGTTTAAACCAACAGAGTCTGTGTTCCCAAAT
GGTCTTTCTCATGAATACTCCATCGTTGCCACTTTCCGGA
TCAGAAAAACTACTAAAAAAGATCGCTGGTTTGTTCTGCA
GATCTTTGACAAAGGTGGAACTTCACAGGTGTCATTAATA
GTGGATGGGGCAAAGAAATCAGTGGAGTTTTTGGCTCTGG
GTTTTTTGAAGAACAGCCTCCTGTATGTGTTCAAGAATCG
AGACCTGCACGCCCTCTTCGATCGACAGTTTCATAAGCTG
GGAGTTTCTGTGGAGAGTAACGCTGTGTCCATCTACCTGG
ACTGTGAATTAATCGAACGACAAGTCACTGCTGAGAGATC
TGGCATAGACGTCAGTGGACGCACCTTCATCACCACTCGA
TTGGAGGACGGGAAGCCAGTCGATGTCGAGCTTCAGGAGA
TCCTGGTCTTCTGTGATTCTCGAATAGCCGACTTGGACAG
ATGTTGTGATTCTCCTGGAGCTATGTGTGAACCGACAGTG
ACCCACAACCCCACAGCAATCCCTCTGGTCACAGGATATC
TTCAGAAAATGTTGTCCATGCCAGCCCAGCTGCCCACTGA
CCGATGCCACTGTCCTGCTCTCAAGGTACTGTAAAGCTAA
AGCAAGAAAACCTTCTTAAAATGGGAACCTAGCACTCCAC
AACAGATCCCGAGGTAATGCCGCATGTGAAATGAATGGCC
AATTAAAGCGCATTTATGCCAGTCCGTATATCTGGATGAC
AGCCAGAGATGGAAATAAAAGCTTATTAGAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations