Transcript

col19a1-201

ID
ZDB-TSCRIPT-090929-13176
Name
col19a1-201
Previous Names
  • col19a1-001
  • si:dkey-49l3.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031164 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031164|OTTDARG00000023829|ZDB-GENE-090312-196 col19a1|OTTDARP00000025323 DKEY-49L3.2-001 LG_ BX322620.13 Danio rerio protein_coding NOVEL, 6802 bp
GGTCGACGAGGGAAAACCGGAGAGCCAGGGACTCCAGGAT
TACAGGGAATGAAGGGTGACCAAGGTGTTGCAGGAGAAAG
GGGCCAGAAAGGCGATCGAGGTGATTCAGGTTTGCCTGGC
CTGGAGGGAGCCGGTGGAATGAAGGGCCAGAAGGGTGAAA
AGGGGGCTGACGGATCACAAGGTCTACAGGGCGCTGCTGG
ACTGACAGGTCCACCAGGACTTGAGGGAAAAGTGGGTCCG
CCAGGTCCTGTTGGTCCTCGTGGTCTTCAAGGAGATCCGG
GCTCTGCCGGTCTGATAGGACTCCCTGGGAAAGATGGAAT
GAAAGGAGAAAAGGGCGATGCAGGCGGAGCGCCGGGGCCA
GCAGGACCCCCTGGCCTCAAGGGTGAGCCTGGTGAGCCCT
GCTCTGTCGGACTTTGCGGTGGGGAGGAGGTTGCATCTGG
TCTGCGAGGTTTACGGGGCCCTAAGGGTGAACGAGGTGTA
CCAGGAGTGCCTGGAGACGCTGGAGAGAAAGGTGAACCTG
GTTTTGGCATCACTGGACCTCCGGGTCTGACAGGACCTAA
AGGGGAACCAGGAAGTCAGGGTCCTCTGGGACCTCAAGGA
CCCATTGGAGTACCAGGAATTGAGGGACCTCCAGGCCCAC
AAGGAAGACCAGGACTCCCTGGACCTCCCGGAGAACCGAC
AGCACTACCAATGGTTGGAGACATGGGGACATTAATGAAG
AACGCCTGCAGTGTGTGTCAGACCAGAGTACCAGGGTTAC
CAGGGCAGAAAGGAGAAAAAGGTTCCCCTGGAGCGTCAGG
TATCCCAGGAATGGATGGAGAAAAGGGGGATCAGGGTCTG
CGAGGCCCAGCTGGAAATCCTGGAAAAGAGGGTCCGAAGG
GAGTGAAGGGCGAGAGAGGCTTTCCTGGTCCAATGGGGGA
CAAGGGTGATGAGGGGTCTCCGGGTGTGCCAGGATTGCCT
GGATCTACAGGCCGCACAGGTTCACAGGGAATGAATGGCA
GACCAGGAGCTGTTGGGCCCCAAGGACAAAAGGGTGATCG
AGGTGCTCCATATTCAGAGGGCAACGGGATGAGCAGTATC
TATAAGCTTCAGGGACCCAAAGGAGATGAAGGAAGGATGG
GTGAGCCGGGACTGATGGGATTACCAGGACTAGAGGGGCT
GACAGGTGCTAAGGGAAAGCCTGGACCGCGTGGTGAGACA
GGGATCCCTGGAGAGCCGGGAAGGCCAGGAAAAGATGGAG
TTCCAGGCTATGAGGGAGCCACAGGCAGACCTGGAGACCG
AGGTACCAAGGGAGAACGGGGAGATCCAGGGATTCCAGGC
GAGAGAGGAGTTCAAGGAGAAAGAGGGAAAACTGGAGATA
AAGGGACCATCGGTCCTCAGGGCCCGCCTGGACAGAAAGG
AGAACCAGGCCCTCCTGGATCTTTAACATCACCAGGGAGC
GTCAAATTGTTGAGTGATACAGCTGCCTTGGAGGAAATTA
AAACATTCATCCGAAATGAAGTATTGCGCGTGTTTGAAGA
GAAATTTTCTGACAGTCAAACTTTGCTGCAAAAGACACCG
GCGGCTATATTAGCAGCACAAGGTCGACAAGGCCCCCCAG
GGCCACCCGGTAATGACGGCTCCCCAGGACCCCCCGGAGA
GCCAGGACCTCCAGGTTCCCAAGGGTATCGAGGGCAGAAA
GGGGAACGGGGTCAGATGGGTCTGGGACTTCCAGGAGCTC
CAGGACCCGCCGGACCACAAGGTCCAGTTGGATTAGGACC
CCAGGGGCCTTCAGGTCCCCCGGGGCCCCCGGGTCCGCAT
GGAAGATGTAACCCCAGCGACTGCTTCCACCCTTATGGTA
GACGGGATGGCTAGAAACTGACACACCCTCATCAATGCTG
AATAAATCAGGCGAAGCAGCTCATCTACAATCCTAATAAA
AACAAGTGTAGGATGCCTCCTGGAGGAGAAGAAACAAGCA
AACCTCATCCCCGCAGAGCAGCCATTACCGCTGATGTCAT
TTCATCAATTCTCTCCGCTTCATTTCCCATAGTTGTGACC
AATGCATTTACTCGTGTTTTGCGGATATGACATGAAAATT
CAAATGCCATCGATACACTAATCACAAGCGACTGAGGCGG
TGCGGTCAATGCAATGCAGGTGAAATGAGAATTTTATTTA
CATTCGCTTCTTTTCTTCAAGCTGACGTGAAGTAGTTTTA
ATTAAATTGTGATGCCGCTATGCAATCTAATGTAGAAAAG
CTCGTGTAAATAACAGACATTTTAATTGCTTTTCAGACAT
TTACTTTTGAAAATATTTAAAAAGCAATGTACTTTCAGTC
CTTTCAGGAAGAACATTGCTCATGAAGGGAGTAAGTTATT
GTCATATTTATCAGCTGCACTGATGATGCATATATAATGG
AGCACTCATATAACCTCTGAGACCACTAGTACAATTATTC
ATCTTTCTCATTAATCATTATACATTTCAAAATTCAACTA
AAATGTATAATTACTAAATGAAACTAAAAAATAATTGAAA
ATATAAGCAATTCATATTTGTGTGTTTATTATTTATTTTA
GATTTTAACATCATCATTATTTCTCTAACCACCATAATTG
ATCAATTTGCAATTATTATTAAAGGGTCATGAACCACAAA
CCCCCCCATTTCTCCGCCGGGTGTTTTTACACCTCTAGAC
TGACAAAAGTCAGGCAAGTGAGTGAGTCCAGCTTTGTTTA
GGTGGGAGTGTCGAGTGGCGAAAGAGGGAAGTTTTTGCAT
GAAAAGGGGAGTTTCAGCATGTGCACGCGTGGATTTTCAT
AGCGGCAAAAACAATACAAACACAGAAGAGACAGTGACTA
CATTTACATGGACATCAGTAATCAAATTATTTGCCTTAAT
TTGAATAAGATTATAATATAATTAATGAGTTTACCTGAGA
CTTTTTGAATGTTCCTTTTATCATCCCGTTTTTTTCCCGT
AATTTCGGGTGTTTCATTCTTAATTTGTCGAATTTAACTG
CAGTTAGGCCCTTTCACTTTCATTTACGAACATTTCATGC
ATGCCCCCCATGACAAACGAGATATTGGATGCGAGGAACT
GCTGGAAGAGTGTTGTTTTAATGGAATTTTTGATATTGCA
CGACGATTGGAAGAAAAAAAATACTCTGCATTTCTTAATG
CAGAGACTCGGTAGATGCAAACAGTAACATCAAACAGCTG
TGTGTATGGACTATACAGTCACAAAATGCGGCAAAAATCA
TACGCAACCCATGTCTCCAAATATTTCTTTTTCTTCCACA
AATTTAATTAGGCAACACAACCTCTCAGTGGTCTGAACAC
TGTACAAGTAAAAACAGTCTTCAAAGCTATATCGTGCATA
TTAATGAAGTAGCACCTCATTCACAATAAAGCGCGCTGAT
TGGTTTGAACCAAGTCTTTCCCATGAATTAAATGATGAAA
ACTCAAAGACGTCACGTATTGGCCGGTACATACAGCCAAT
CTCCCTGCTGGATTTTACACAATGATCTCATCATGGTGAT
GCAGCGTCAAATTTTATGTTTGAACCAGAAGAACGAATTT
GCTCGAAATAACACAAACAACCAATTTTCAGGGTTTTTTT
GGGTGAAATGTATGTGTCCTAATAGTGTCTTTAGTAGCGT
GGGACACATATATGATTGTCAACATCTCAAAAAAATGTAT
TTTGGTGTTTCATGACCCTTTAATATCTCTCTTTTTTATC
TAAAAGTTGTTTATTTTGTGTTTAAAATGGGTAAGAGAAT
CTCCTAATTTTAAATATGGTCTCCTACTTTTATGTAAATG
TTTGACCAAACACAGCAAATAGTAATAATTGAAATAATAA
TAATAATAGCGATGTTGCCGTGTGGCTGGTGAGGTCAAAA
CTGCTCATGACATTAATAAGCTTTAATTGTTTACAGGGAA
ATAAAGCGATGTTCCTTTAGTCAGACTGTTTGAACACCTC
CATAATGGTGTAGTATGTATATTTTGGTCTCTACTAGGTT
TGATTTTCGGAAAAAAAAAGAAAAAAAAGATGTGAATTGC
TTTTTTATTTGCATATTTATCTTTGGCTTCGTGTGGAAAG
CGTCCTTCCATGTTACTTGAATATTTTTTTTATAAGACAA
CATATTTGTCAATATCATATTCACAAATGGCAAACCGTCT
TATTATCAAACCTTACATTTCATGGGCAGCAGTTTGTCTT
AAGACCATGTTTTTTTGTAATTCAGGTCTTTATTTATTGT
AGTCCGGATTCATGTTTTATTTATTGTGTTTATCTTGAGA
TTTTACTGTACAAGTCATTGAATCATTTGACTCTCTGTTG
GGAAGATGAACAGTTCTTGAGTGGTGGATGGAGAACAGTT
TTGTGATGTTTTGCATTTTGGTTTGTGCTGCTTTCTTCTT
TCTTCCTGAGTCTTCCTGTTTTCTTTTAGTACACTGGGGT
CAAATATGTAGACGTTTGGTGGTCACACTCGCCAAGACTG
CATTTATTGCAATTTTAATTCTGTTGACATGATGTCTGTG
AATTGCAGAGCTTTTACAAATGGCAAAACAAATCCATATT
GAACAGATGCTTTCTTTAGTGTTGCTTTTTTGTTATTGGG
AGGAAAGAGCGCAACATATATTTAAGTATGAATCTAAATG
TTGCGTTGTTGGAGCAGTGTTGGGTGTAATTAGTCTCAAA
TTAAATGGTTACTGTAATTAAATTACTTTTCTGCTGAAAA
AAAATTAGGTAAGGGATTACTTTTTATATTTATGTTATTT
AATTAGTTACTTGCTTAAATACTAGACATAAATTCAATCG
TTCCATATAAATCAATTCTGAGAAGCAGAGTAATTTTGTT
TTTTTATGATTAAAAATATATTTTGCTGAATAATAATATT
TTTCATCTAAATAAAACTACATTATTAAACATGTCATGTT
TTTTTTTTCTTGGGAATAATATTTCTAAAGGAAATGTTGA
CGTCACATCGAACCAGATTTTGGTAAAAGCCCAAACAATA
CAATTTTAAATATAACAATATATTTTTTTGAATCTGAAAA
AAATAGTTAAAAATGTATTTAGTACTGTATTTAAAAGGCT
TTTTTGGTGATGGCAGCTTAAGGACGCCTCATCTGAAGAA
TGAAGTCACATGAATTGCTCAGCTGAGGTTTTTCTCACAA
ACTTCAACAGAGTGTCAAAATCTTAATGGTTCTGTGGGTC
TTGTCTCAAATCTGATCTTTATTTTGCTTTTCTATTGTAT
TCCAGTCAGGTGATTGGCTGGGCCATTCTACAGCTTGATT
TTCTTTCTCTGAAAGCATTTGAGAGTTTCCTTGGTTGTTT
TTTAGATCATTGTCTTGCTGAAATGTCCACCCTGGTTTCA
TCTTCATCATCCTGCTAATGTAGATGTTGGACTGAAGCAG
CTAATATTCATTTACATTGAGAAAGGGCAGAGGTACTACT
GAGATATTTTAGTTGCTGTCTGGGCTTTCACTGCCTTTCT
AAACCTCCCTTTCTTCATGTGTTCAATACTTATTCCTTGC
ATTTTATTACACATAACTTCATTTAAAAATTAATTTGTTT
TTTGTTTTGTTTTTTGCATATATTTTGCAAATATAGATTT
CTTTGGTTGTTACCAACCTACCAAAATTTCAAGTCAACAG
CATCCTTAGAAATATGTTTTTTTTTTTTTTTAAATTGTGA
CATATTCAATACTTATTTCCCCACTGTATATAAAAAATAA
GTTGTTAATGATAAATGTTAATTTTTGTTTAATAAAACAG
TTTGACTCAAATGTAAATAATATAAAGTTGAATTTTTATT
GTCTTTGCATTGGGATTTATGTGGATTTCTAATATTGAGT
TAAGTAATTAAATTACGTATTGAGTAACTAAGTTACTTTT
TAGACAAAGTATTTATCGTGTAATATGTACTTTTTTTTTT
TTTTTTAAGTAATTTAGCCAACACTGCTCTGGACACATCT
AGATGTTCACTATTAGTGAATCACTGCAAATGTTTTTGCA
GCTTTACTCCTCCAAGCAAAATATTAATAATAGTTAGAAT
TAATAATATTAATTAGAGTAACATATGAAAGTACTATTGT
TTTGTATTTAGCCTTAATCAGAAGCAATATTTATTTTTTA
AGCATTATTATTCCAGACTTTTGACCCCCAGTGTGCATTT
TTTCTTTTTTTTTCTTTTTTTCTTCCTCCCTTTCTTCCTT
TCTTTTTGCACATAGGATTAAGTGTGACAAAGCAAACCCT
TGTTAGGTTTTTGCTGTTTTATTTTTATTAATTATAAAGT
TTTACTGTTTTTATTTTTATATGTACCAGATTACCTCTGC
TGAGAGCTGAAATATTGATGGTTTCAGGTCTTAAGACTAT
TTTGGTGAAAACAATTGTCTAGAATCCTTCCAAGTAAGCA
TCTCAGAGTTGGCATGACTTCATATTTACCTTTATTAGTA
GTTCTGTTACCTTTTTTATTATTACTTTTACATAAATGGG
CTATTATTAATGACATGTAGCATGGATACAATATGTTTCT
CAAGGGCTAATACTGTGGACTTACTTGAAGGACAGTCTTA
AGACAAAAGCCCACATCTACCTGATATGCACTGCATCACC
TGATGGATCATCTGGAGGAGGACTGTGTTTCAGTGTGGCT
CTGTTTTCAATATGACAAATGCTCACTGTGGTCAGATACA
GTAGCACACATGCATCGTGTGTCAGTTTATTAGCATTTTC
TTTTGTGCTTGGTCTTGTAGATGCATTTGGTTTGCATATT
TTACATATCGGTAAATCATTTAAATAAATGTCCTTAATTT
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations