Transcript

top2a-201

ID
ZDB-TSCRIPT-110325-2614
Name
top2a-201
Previous Names
  • top2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050748 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050748|OTTDARG00000035642|ZDB-GENE-030131-2453 top2a|OTTDARP00000039850 top2a-001 LG_ BX470262.7 Danio rerio protein_coding KNOWN, 2839 bp
GTCTCTCTGATGATGACCATTGTGGGTCTTGCTCAGAATT
TTGTGGGCAGTAATAATTTGAACCTGCTCCAGCCTCTGGG
TCAGTTTGGCACACGTCTCCATGGCGGCAAAGACTCAGCC
AGCCCCAGATACATCTTTACTATGCTCAGTACACTTGCTC
GTCTACTGTTCCCTGTGGTGGACGACAACCTGCTGAAGTA
CAACTACGATGACAATTTGCGAGTGGAACCGGAGTGGTAC
ATGCCCATCATCCCTCTGGTGCTGGCTAATGGAGGTGAAG
GCATTGGCACAGGATGGGCCAGCCGCATCCCTAACTATGA
CGTGCGAGAGATCATCAACAACATTCACCGCATGCTTAAC
GGAGAAGAGCCCCTCCCCATGCTGCCCAGCTATAAGGGCT
TCAAGGGCACCATTGATGAGCTGGCAAAGAATCAGTATGT
GAATAATGGAGAAGTGGCCATCATTGACTCCACCACCATC
GAGATCACAGAGCTGCCTGTCAAAACCTGGACACAGACCT
ATAAGGAGAATGTGTTGGAGGTGATGCTGAACGGCACAGA
GAAGGTCCCTGCTCTGATCACAGACTACAAGGAGTATCAT
ACAGACACCACAGTGCGTTTTGTTGTTAAGATGACAGAGG
AGCGCCTGAGAGAGGCAGAGGCAGCTGGACTGCACAAAGT
CTTTAAACTCCAGAACCTGCTGACCTGTAACTCCATGGTG
TTATTTGATCATGTGGGCAGTCTGAAGAAGTATGAGTCTG
TTCAGGACATCTTAAAGGAGTTCTTTGAGCTCAGAATGAA
ATACTACGTCCTCAGGAAAGACTGGCTTGTAGGAATGTTG
GGAGCTGAAAGTGCCAAACTTTCCAACCAAGCCCGATTTA
TTCTGGAGAAGATCCAGGGCACACTGGTCATTGAAAACAA
ACCGAAAAAAGAGCTGATCCGCATGCTTCAGCAGATGGGC
TATGACTCGGACCCTGTTAAAGCATGGAAAGATGCTCAGG
AGAAGGAAGAAGAAGAGGATGCTGAGGATGATGATGAGAA
GGAGAAAGAGGACACGTCTGGCCCTGATTATAACTATCTG
CTCAGCATGCCCATGTGGTACCTAACCAAAGAAAAGAAAG
ATGAGTTGTGCAAGCAGAGAGATGCAAAGATGACTGAGTT
GAACACACTCAAGATGAAGGCCCCTGCTGATCTGTGGAAA
GAAGATCTGGCAGCTTTTACTGAGGAGCTGGAGCGTGTGG
AACAGAAAGAGAAGGAGTCACAGAATGCAATGCCCCTGGT
GAAGGGTAAAGTGGGCAAACCAAAAGTGGTCAAGGTAAAG
AACGAGACCATGCCTACACCGCAAGGCCGCAGAGTTATCC
CCCGCATCACCAGCACCATGAAGGTCCAGGCTGTAAAAAA
AGAGCGAGGCAAAGGATCGAAGAAAGAGGCTGGTTTGGTG
ATGAAGATGGAGTTTGATGATGAGGCAGACGCAGCAGCTG
ATGGCACTGGGGTGGGATTGGCTGCAAGACTTACAAAGAA
GATCAAGAAAGAGCCAACCAAAGACAAAGGCTCAAAGTCA
GGAAAGCAGACCACCCTCACTTTTAAACCAGTCCAGAAGA
AGAACCCCTGGTCTTCTGATGAGGGAGAGTCTGATTCTGA
CCTAGAGTTGATGTCTGAGGAAACAGCCCCAAGAGAAAAG
AGAGAACGCAGAGCCGCTGTTGAAAAGAAGTACAGTCTGT
CAAGCAGTGAGGATGAATTTGATGACTTTACGAAGAGCAG
TAAAACGAAGCGTGCTGTGATTGAGGACGACGAGTCTTTC
AATCCAGAACCCAGTGCTGCACCTGACAGTGATGTGGACT
CTCCTCCTCCACCTGTTGTGAAAAAAGCCCCAACAAAAGT
TGCCAAAGCAAAGGCAGAGAAACCAGAAGCCAGCAGCAAG
TCTAGCTCTCATTCTGAAGCCAGTCAAGAGCCGGCTCCTA
AACCTGTGAAGAAAACTGCTGAAGGAGCTGCCAAAAAACC
TCCTGCCAAGATGACAAGTGCCGTTTCAAAGAAGAAAGCA
GCTGATTCAAAACAGCCTTCGATCCTTGACGTGCTCTCCA
AGGCAAGCCCTAAGAAGTCCAAAGTTGTCAAAAAGCCAAC
TGCTGTCAAGCCATTGTCCAGCGACTCGGACAGCGCAGGC
CCTGCTGTCACAAAGAAACAAGCCAAGAAGAGGAAGACTG
TGCTGAGCAGTGACCAATCAGACAGCTCCGACTCTGACAG
CGGCAATCTCATGTCCCGCCTCAAGGGCAAGAGCACTGCT
GGAAAGAAAGCAAAGAGCTGGGAGGATGATGAAAGCTTTC
AGTTGGAAGAGACTGAGAAGGTGGTGGTCTCTGCAGCCCC
CAGGAGCCGAGCTGCCCGCACCACTAAACCTGTGACCTAC
GCACTCGATTCAGACTCTGACGATGAAGATTAATGTGCTG
TTACATATTGTTTTAATGAATATAATCATAAGGGTAAAGT
TCATACTGTAATGCAAAAAGCCTGTTTTGTTTGGCTTAAA
TGAAAAACTAGCAATCTAACAGTTTAATTTTAAGCATTTT
TATAATGTCATAACATTGTTACACAACATTGTTGAATGTT
GCTGTTTTTTATATGTTGTCTTGTCTTTATGTAAATATTT
TATCTGTTCTCTTTCCTTATTGAGCTTTGTAATAAATGTG
TTTTCAATGAGAACTGTTAGTGTCTGAAATATTAAATATG
CTCAATATTAAATGTGCTCATATGCTTGTATTCCAGAATG
TGATCCATTTACAGTATATGTCATGCACGTCCACCTGCTA
CTTTACCCAGCTAGGCCTATTTAGTACTGCTGAAAATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations