Transcript

dhrsx-203

ID
ZDB-TSCRIPT-110325-2037
Name
dhrsx-203
Previous Names
  • dhrsx-003
  • dkey-239l13.1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048314 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048314|OTTDARG00000031833|ZDB-GENE-060620-2 dhrsx|OTTDARP00000037910 DKEY-239L13.1-003 LG_none BX784035.4,CU041391.8 Danio rerio protein_coding NOVEL, 352 bp
AACAGCTGTTTTGCTATCCAGCATCCAGAGTAAATGGAAA
AGATGGAGTTTATGTGAGAGTGCATGTTTGTCTGGAGGCT
TAGCACTTCTGGAAAGAGTGACTGTGAGTAGGGATTCAGG
TCAGTGTTAGAACACGCTCAGGGGAAGCATCCTCCCAGGC
CCCGAAAGGATAAAGAAACATGTCTGCTCAAATAGATGAA
GACAAGGAGACAAGATAGAAGATCCCCGGGTCACGCTGAC
ATATTTGCCCGAGCAGAATGGAAAGGTTGCCATAGTTACA
GGGGGAACCAGAGGAATGGGATATGAGATTTCCAGACATC
TGGTCAGCCTGGACATGCATGTGATCATTGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations