Transcript

dhrsx-204

ID
ZDB-TSCRIPT-091110-476
Name
dhrsx-204
Previous Names
  • dhrsx-001
  • ch73-286n19.3-001
  • dkey-239l13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044349 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044349|OTTDARG00000031833|ZDB-GENE-060620-2 dhrsx|OTTDARP00000035301 DKEY-239L13.1-001 LG_none BX784035.4,CU041391.8 Danio rerio protein_coding NOVEL, 809 bp
TCAACTTCAAACATGTGGAGGTTGTTACATTGTATCCTCG
GCTTCATCAGGCTCTACTTAGATGGCGTGAAAGTCCTGCT
ATACCAGCTTTTCAACAAATCTTTCAGGCTGCCAGATTTG
CCCGAGCAGAATGGAAAGGTTGCCATAGTTACAGGGGGAA
CCAGAGGAATGGGATATGAGATTTCCAGACATCTGGTCAG
CCTGGACATGCATGTGATCATTGCTGGAAATGAAGAAGAG
GAGGGTCTGGCAGCAGTAAAGAAGATTCAAGAAGAGTTGA
ATCAGGGAAAAGTGGAGTTCATGTACTTGGATTTGGCCTC
TTTGACATCTGTTCGCCAGTTCGTCCAGAGATATAATGCC
AAAGGTTTGCCTCTACATGTCCTTGTCAATAATGCTGGTG
TTATGCTTGTTCCGGAGAGGAGAACAGAGGATGGATTTGA
GCTACACTTTGGGCTAAACTACCTGGGCCATTTCCTGTTA
ACCAACCTGTTGCTGGGTGCACTTAGGAAGACTGGCAAAC
CTGGCAAATGTTCCCGAATAGTTATTATGTCTTCAGCTAC
CCACTATGGAGGGAGATTAACTCTGGATGACTTGCAGGGA
AGGTTATGCTATAGTTCCCATGCTGCATATGCTCAGAGTA
AGCTGGCCCTGCTGCTGCTCTCCTACCACCTGCAGGAGCA
GTTGCTGGTCAGAGGAGATCCCGTGACGGTGAATGCGGTG
GACCCCGGCATGGTGGACACGGCCCTCTATGACAATCTGT
GCAGCCCGGCCCAGGTGGCCAAGAAGCCTTTCGCTAAACT
GCTCTTCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations