Transcript

pparda-202

ID
ZDB-TSCRIPT-110325-1390
Name
pparda-202
Previous Names
  • pparda-001
  • ch73-352p18.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049330 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049330|OTTDARG00000034772|ZDB-GENE-990415-212 pparda|OTTDARP00000038705 CH73-352P18.3-001 LG_ FP067424.7 Danio rerio protein_coding NOVEL, 1735 bp
GGAAAATAACCCCAACGGAAGGAGTTAACGGGCCTTCCAA
GAGGAAAGATCTGTGAAAAAGAGCAGTGATGAGGGCAGCG
GCGGCAGCTCATGAGTGTGTGTGAGATGGACAGGAGACAC
GTTCTGGCCCTCAGGAGCCGATTACCCAGAAACCTCGGCT
CAGTGGGCGGAGTCTACATGGACCCCGGAGACTCCTCCCC
CTGCAGCAGTCAAGGGGAGGGGCCCGACGACCAGCGTCTG
CAGGATGTGCTGTGCGAGCTGGGGGAGGGGGCGGGGCTTA
ACCTGGAGCTGGAGTCTGAGGGGGGCGTGGCTCTGCAGGG
GGAGGAGCTTAGCTGGGAGACGAGCCGGCAGGAGGAGCAG
AGCAACACCAGCTCAACCAGTCCTGACCGCAGCAGCGCCT
CCACAGATCTCTCCACAGCTCTCTCCGAGCAGCTCCTGCG
GGGTCGTGAGGAGGTCTCGGGGATCAACATGGAGTGTCGG
ATCTGTGGAGATCGTGCCTCAGGCTTTCACTACGGCGTCC
ACGCCTGCGAGGGCTGCAAGGGATTTTTCCGGAGGACCAT
TCGTATGAAGCTGGAGTACGAGAGATGCGAGCGCAGCTGT
AAGATCCAGAAGAAGAGTCGCAATAAATGCCAGTTCTGCC
GCTTTCAGAAGTGCCTGATGCTCGGGATGTCTCACGACGC
GATCCGCTATGGCCGTATGCCAGAGGCGGAGAAGCGTAAG
CTAGTCGCAGGTCTGCTAGCTGGAGAAAGGGGCTCTCAGA
ACTCCAACGAGTCCGATCTGAAGACTCTGGCCAAACGGGT
CAACAACGCCTACCTGAAGAACCTGAACATGACCAAGAAG
AAGGCCAGAAACATCCTGACCGGCAAGACCAGCGCCAGCA
CGCCGTTTGTGATCCACGACATGGACTCTCTGGTGCAGGC
GGAGAACGGGCTGGTCTGGAACCAGGTGATCCACGGAGCG
CCGCCCAATAAGGAGATCGGAGTTCACGTGTTTTACCGCT
GTCAGTGCACGACCGTGGAGACCGTACGAGAGCTGACCGA
GTTCTCCAAGAGCATCCCGGGCTTCATCGACCTCTTCCTC
AACGACCAGGTGACGCTGCTGAAATATGGCGTCCACGAGG
CCATCTTCGCCATGCTGCCGTCACTCATGAATAAAGACGG
GCTGCTTGTTGCAAACGGACGGGGATTCGTGACGAGAGAG
TTCCTCCGCAGTCTGCGCAAACCCTTCAGCGAGATCATGG
AGCCCAAGTTTGAGTTCGCGGTCAAGTTTAACGCACTGGA
GCTGGACGACAGTGACCTCGCTCTGTTCGTCGCCGCAATC
ATCCTGTGTGGAGATCGTCCAGGCCTCATGAACGTCCATC
AGGTGGAAAAGATCCAGGACAGCATCCTCCAGGCCCTGAA
TCAGCACCTGCAGCTCAATCATCCCGACGGACGCTTCATC
TTCCCCAGACTGCTGCAGAAGCTGGCGGACCTGCGGCAGC
TGGTGACGGAGAACGCTCAGCTGGTGCAAAAGATCAAGAA
GACGGAGTCCGAGACCTCGCTGCACCCGCTGCTGCAGGAG
ATCTACAGGGACATGTACTGACTGCCTGTCCAATCAACCG
TGGAGATACCATCCGGAGAAACCCTTATTTCTACGTGAAG
TGAGGATTTTGAACTGAACTCTTAAAAAGAGACAGAGTGT
TCTGCAATGGAGCGTTGTGCAGGTCGTAAGTAAAACTGTT
TCACACTAAACGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations