Transcript

ncoa6-203

ID
ZDB-TSCRIPT-100915-689
Name
ncoa6-203
Previous Names
  • ncoa6-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046073 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046073|OTTDARG00000032904|ZDB-GENE-080403-12 ncoa6|OTTDARP00000036356 ncoa6-003 LG_none CU861507.3,CU929179.4 Danio rerio protein_coding KNOWN, 668 bp
CTGGAACGCTTCAACTCTCTAGTGTTGTTGCCAGTTCTTC
TCCACTCTCTAGTTTGCCGCCAGTTTCAGTTGCTGCATCT
GCTGCTGCTGTTCCAGCATCTCTCACTACAACTTCTGGCT
CCTCCACATCTACACAGCTCTCTGGTGAACCGCAGCCACT
CTCAGTGCCAGAGACTAGTGCACCTGACACCACTGAAACA
AAAGAAGCACCTGCCGATGCTCCTAACATCTCAGGACAAG
GTGTTACCACTGCAGCAGAGCAAGGGGATACAAGGGCCTC
CACTGAGAAGGCTAAAGGTCCTAGTCGACGAAGCTCACGA
ACAGACAAGGAGCCCGAAGAGGAAGCATCTGACAACGGAC
AGAGAAAAAGAGCTGCTCGGCCTGGCTCGGCTTCTTCTAA
CACGGGAAAAGAATCAAACACTGGAGCCAGTCCCACCCAG
GCAAAGCGAAGGAAGTCGAAGTAATCCCGACAGCTGAATA
AACCTGTGAATTGTACATTATTAGTAGTTTTATCTGCTGT
TTTTTTCCTATTGCTCTAAGGTAAACCTGTACAGAAAGTT
TTTTCTTCCTATTTTTAATCATGATACTGTATTTTGTCTC
TGGCTACTAGATGAGATCACGTGTAGAACTGTGTAGGATG
TGTTTGTACGTCATTGTTTTGGTGTGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations