Transcript

ncoa6-004

ID
ZDB-TSCRIPT-100915-1205
Name
ncoa6-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046074 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046074|OTTDARG00000032904|ZDB-GENE-080403-12 ncoa6|no_translation ncoa6-004 LG_none CU861507.3,CU929179.4 Danio rerio protein_coding KNOWN, 835 bp
TTCTTCTCCACTCTCTAGTTTGCCGCCAGTTTCAGTTGCT
GCATCTGCTGCTGCTGTTCCAGCATCTCTCACTACAACTT
CTGGCTCCTCCACATCTACACAGCTCTCTGGTGAACCGCA
GCCACTCTCAGTGCCAGAGACTAGTGCACCTGACACCACT
GAAACAAAAGAAGCACCTGCCGATGCTCCTAACATCTCAG
GACAAGGTGTTACCACTGCAGCAGAGCAAGGGTAAGAAAA
CTGCATTAATAAGCTACACACTATCTTCATGCTCACAACC
ATGTGTGAAGACTGTCTGACCTCTGCATCATCATTTTAAT
TTCTAAATGATTCTCAGAATTTTAAAATGGATGTGTTTCA
TACCTTTGTTGATTCAGTGTTTCAATCAGCGTAATTTTAT
TAATCTGAATGATCTCACCTCATGACACTAATCATGGAAT
GATTCATGAAATCATTCTTTAACCTGATCTGTACTCAAAT
ATGGGGAAGGAGGAAAAAATGTTGTTCAGCATCAAAGCAG
TTTACCGCTGTTTTTCCACTTCTATAACAGATGGGCAAAG
AAAAGAAAGACGCCCGTCAACTTAGCCCCAAGGTATGTAT
ATACCAGACCTGTAGATCCCCTGCACGGGTCCGTGCGCAG
GGCAGCATGACCGTTTAGTAAATATGGTCATTACAAGACG
GACGTTATCTGTGGTAGATGAGGAAAAACAGCAAGTATGA
ATTCCTCAGTTGCACAAGGGCCAGAAGTGCTCATTTGCTC
AATTTTAAAACAGCAGAAAACTAGTGTGTGTGTGTGTGTG
TCTGTGTGTGTGTTTATATATAGCATACAAGTGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations