Transcript

en1b-201

ID
ZDB-TSCRIPT-100915-1225
Name
en1b-201
Previous Names
  • eng1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046150 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046150|OTTDARG00000032945|ZDB-GENE-980526-6 eng1b|OTTDARP00000047651 eng1b-001 LG_ CU861653.11 Danio rerio protein_coding KNOWN, 781 bp
GAAAGAGTTTGTTAAGCGCGAGCTGTCACACGGGGCAGCG
AGTCAGGGACTGCGGAGCATCGCGCGATGTATTGTCTGAC
ATGAATAACGGGTGTGTTTTGACACTTGAAACGCCTTGAT
CGCGGAAAGCATTCCGATGCTATGACAGTCGCTTCTTTTA
AGGTATTTCGTATACCTTTAATTTAACACTATAGACTGCA
TTCTTGTTTGTTGTTATCCGGATACTGTTCATTGCAACAA
GTGGAATTTTGGTGTGCAGACCACGATCCAGCTGTCATGG
ACGAGCAAAAGGATCAAAATAGTCGTGATTCGACTGAGTC
TGAGAGCGTCTCGCTCTCACCCAATATACCATCTCCTCCG
ATTTTACCTCACCAGGCTGCGCAGCAAGCCCACAGAACCA
CGAACTTTTTCATCGACAATATTTTAAGGCCAGATTTCGG
CTGCAAGAAAGATCCTGGGAGTAGGGATCGGGCGCAAACG
TCGGGTAGGGAGAATGTTAACCCAATGGTAATAAGGCCGT
CGCATAATAGCAGTCTTTGCCAGGATTCAAACTGCAGTAG
TGACAGCACTTCTTCGTCCTCGTCGTCTTCGCCATCCTCA
AAGCAGTCCTCGGTAAAGCATTTCGAAGGAAATGGATCTA
CCGCAGCAAGGAACGGGGAGAATACGCCGTCGATAATGAT
GGTGAACGCCAACGGGGGAACTCCGCCAGCTAAAGAATCA
CAGCCTTTACTATGGCCTGCGTGGGTGTACTGCACCAGGT
ACTCGGACAGACCTTCATCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations