Transcript

mnx2b-202

ID
ZDB-TSCRIPT-091203-68
Name
mnx2b-202
Previous Names
  • hlxb9lb-002
  • mnx2b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045695 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045695|OTTDARG00000019500|ZDB-GENE-040415-2 mnx2b|OTTDARP00000036066 hlxb9lb-002 LG_ CR762428.7 Danio rerio protein_coding KNOWN, 1152 bp
TGCGCGTAAAACGCAGCTATCAGCGCAATTACCTGCAACT
CTAAACACAACAAAAGTGTTGCAATGGAAAAGTCAAAGAA
CTTCAGGATCGACGCCCTTTTAGCTGAAGAACCACATCGA
GGGAGCCGAGAAGTTTCCCCTGGACTGAGCAGCGACAGCC
CGACTGGGAGTCCGGTGTCCTGCAGGCGCGGTGACACCCC
GTCCCCCCGCGGGACCCCAGGTGCCATACACCTCCAACCC
GGAATCATACCGAAACCAGGGCTGCTCAATCTCCCTCACC
CGGGACTCACTTCTATCCCAGGCATGTACACGACGCCCAT
GTACCCCATTTCAGCATTGGGAGGTCAGCACCCTGCACTA
GCGTACACTGGGTTCACCCAGCTGACGCAGCCGTACCCGG
AGCAGCTGAAGGCGGCGGCGATGGCCGGATCATTACCGCT
GGAGCATTGGATACGAGCTGGCATCATGGTACCACGACTG
CCCGATTACACCTGTGAGTGGGGTAGCATTCAGATGACTG
CCCCTCAGTCTGGTTTGATGGGTAAATGTCGAAGGCCTCG
GACAGCATTTACTAGTCAACAACTACTGGAGCTGGAAAAC
CAGTTTAAACTTAATAAATACCTTTCCAGACCCAAACGCT
TCGAAGTGGCCACATCTCTAATGCTGACTGAGACACAGGT
GAAGATCTGGTTCCAGAACCGGCGGATGAAGTGGAAGCGC
AGTCGTAAAGCTAAAGAGCAGGCGGCGCAGGTGGAGGTGG
AGCGGCAGCGTGGAGGAACCAAACCCAGCGGACGGGACAG
CAGACGCGCTCCAGCAGCTCCCAGTGTGGAGGAACAGGAG
GAAGAGGAGGAGGAGGAAGAGGAGATAGATGAAGACGAAG
AGGACGAAGAGGACGGACAACACAAGTTCATCAACAACAG
CCTCAGCGTGTCCCGATCCACAGACTTTCTGCACCACACC
GCTGCGTTATATCATCCCGACAGCCCCTTCTCGGAGGACG
ACATAGAGGAGCTGCATGGAGGAGAGAGGAAGATCCGGGC
AGGGTTATGAAGACTTGTTTAAATTACTATGGAACTTTGA
CTCTATGGTAGCATTAGGGGTAAATATCAGCCAGCCTTTT
AGACACTTATCAGTGATGGCACTGGACATTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations