Transcript

mnx2b-201

ID
ZDB-TSCRIPT-090929-6909
Name
mnx2b-201
Previous Names
  • hlxb9lb-001
  • mnx2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023975 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023975|OTTDARG00000019500|ZDB-GENE-040415-2 mnx2b|OTTDARP00000019856 hlxb9lb-001 LG_ CR762428.7 Danio rerio protein_coding KNOWN, 1031 bp
CGTAAAACGCAGCTATCAGCGCAATTACCTGCAACTCTAA
ACACAACAAAAGTGTTGCAATGGAAAAGTCAAAGAACTTC
AGGATCGACGCCCTTTTAGCTGAAGAACCACATCGAGGGA
GCCGAGAAGTTTCCCCTGGACTGAGCAGCGACAGCCCGAC
TGGGAGTCCGGTGTCCTGCAGGCGCGGTGACACCCCGTCC
CCCCGCGGGACCCCAGGTGCCATACACCTCCAACCCGGAA
TCATACCGAAACCAGGGCTGCTCAATCTCCCTCACCCGGG
ACTCACTTCTATCCCAGGCATGTACACGACGCCCATGTAC
CCCATTTCAGCATTGGGAGGTCAGCACCCTGCACTAGCGT
ACACTGGGTTCACCCAGCTGACGCAGCCGTACCCGGAGCA
GCTGAAGGCGGCGGCGATGGCCGGATCATTACCGCTGGAG
CATTGGATACGAGCTGGCATCATGGTACCACGACTGCCCG
ATTACACCTCTGCCCCTCAGTCTGGTTTGATGGGTAAATG
TCGAAGGCCTCGGACAGCATTTACTAGTCAACAACTACTG
GAGCTGGAAAACCAGTTTAAACTTAATAAATACCTTTCCA
GACCCAAACGCTTCGAAGTGGCCACATCTCTAATGCTGAC
TGAGACACAGGTGAAGATCTGGTTCCAGAACCGGCGGATG
AAGTGGAAGCGCAGTCGTAAAGCTAAAGAGCAGGCGGCGC
AGGTGGAGGTGGAGCGGCAGCGTGGAGGAACCAAACCCAG
CGGACGGGACAGCAGACGCGCTCCAGCAGCTCCCAGTGTG
GAGGAACAGGAGGAAGAGGAGGAGGAGGAAGAGGAGATAG
ATGAAGACGAAGAGGACGAAGAGGACGGACAACACAAGTT
CATCAACAACAGCCTCAGCGTGTCCCGATCCACAGACTTT
CTGCACCACACCGCTGCGTTATATCATCCCGACAGCCCCT
TCTCGGAGGACGACATAGAGGAGCTGCATGGAGGAGAGAG
GAAGATCCGGGCAGGGTTATGAAGACTTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations