Transcript

ccr9b-201

ID
ZDB-TSCRIPT-091110-1921
Name
ccr9b-201
Previous Names
  • ccr9b-002
  • ch211-124i7.1-002
  • ch211-149n12.2-001
  • ottdart00000044316
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044316 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044316|OTTDARG00000031802|ZDB-GENE-070301-3 ccr9b|OTTDARP00000035075 CH211-124I7.1-002 LG_ CT737210.9 Danio rerio protein_coding NOVEL, 953 bp
ACAGAGCATGGATATCTCCACAACTTCAGAATATGAAAGT
GGTGCGTTTAATTTTACAGATTTTACCAACTTGGATGGAA
AAGAATTTAGGGTTTCACATGCTTCGGAGGGGCCCTGTTT
ATAACGACCACTGTGGCAGATTACTGATACTGATGACTAC
GAACCAGAACTGGATGGATTATGTAGCAAAGAATTGGTGC
GACAGTTCAGTAAGAACTTTGAGCCTCCTCTCTACTGGAT
CATCTTTGTTGTGGGGGCTTTGGGCAACCTACTGGTTATC
TGCATCTTCACAACTGTGCGGAACCGTCTCAAGACCATGA
CCGATGTGTACCTGCTGAACTTGGCAGTGGCTGATCTTAT
TTTCCTAGGTACATTGCCCTTCTGGGCAACAAATGCAGCT
CAGGGATGGGTGTTCCACCAGGTCATTTGCAAAGGAGTTT
CAGCCGCATACAAAATCAACTTTTTTGCTAGTATGCTCTT
GCTCACTTGCATTAGTGTGGATCGCTACATTGCCATTGTC
CATGTAACTGAAGCACACAACTACAAAAACAAACGCATGT
TACATAGTAAGATTACATGTGCTTTTGTGTGGCTGGCCTC
CTGCATTTTAGCTCTACCAGAATTTATTTTTGCCAAAGTG
AAAAACATTGAGCCACAGCACAACTCATGTGTCATGGTAT
ACTCAATAATGGATAATAACCGTACAAAAGTTTTGGTGTT
GGCTTTGCAGATTTGTGTCGGTTTCCTAGTTCCATTTATG
GTCATTGTCTTGTGTTACTCTGTCATTATTCGTAAACTGA
TGCAGGCTCGGAGCTTTGAAAAACACAAGGCTTTAAGGGT
AATTATTGCAGTTGTGGCTGTTTTTGTTTTCTCACAGTTG
CCGCTTAATGGATACCTTATTATAGAAGCAGGCCAAGCCA
ACAATGCCACAATTACAGACTGTGAAGTCATGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations