Transcript

ccr9b-202

ID
ZDB-TSCRIPT-091110-1199
Name
ccr9b-202
Previous Names
  • ccr9b-001
  • ch211-124i7.1-001
  • ch211-278m12.1_2-001
  • ottdart00000044315
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044315 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044315|OTTDARG00000031802|ZDB-GENE-070301-3 ccr9b|OTTDARP00000035074 CH211-124I7.1-001 LG_ CT737210.9 Danio rerio protein_coding NOVEL, 1446 bp
GCTGACTGTTGTGAGAGCCAGAGAGAACAGAGCATGGATA
TCTCCACAACTTCAGAATATGAAAGTGGTGCGTTTAATTT
TACAGATTTTACCAACTTGATTACTGATACTGATGACTAC
GAACCAGAACTGGATGGATTATGTAGCAAAGAATTGGTGC
GACAGTTCAGTAAGAACTTTGAGCCTCCTCTCTACTGGAT
CATCTTTGTTGTGGGGGCTTTGGGCAACCTACTGGTTATC
TGCATCTTCACAACTGTGCGGAACCGTCTCAAGACCATGA
CCGATGTGTACCTGCTGAACTTGGCAGTGGCTGATCTTAT
TTTCCTAGGTACATTGCCCTTCTGGGCAACAAATGCAGCT
CAGGGATGGGTGTTCCACCAGGTCATTTGCAAAGGAGTTT
CAGCCGCATACAAAATCAACTTTTTTGCTAGTATGCTCTT
GCTCACTTGCATTAGTGTGGATCGCTACATTGCCATTGTC
CATGTAACTGAAGCACACAACTACAAAAACAAACGCATGT
TACATAGTAAGATTACATGTGCTTTTGTGTGGCTGGCCTC
CTGCATTTTAGCTCTACCAGAATTTATTTTTGCCAAAGTG
AAAAACATTGAGCCACAGCACAACTCATGTGTCATGGTAT
ACTCAATAATGGATAATAACCGTACAAAAGTTTTGGTGTT
GGCTTTGCAGATTTGTGTCGGTTTCCTAGTTCCATTTATG
GTCATTGTCTTGTGTTACTCTGTCATTATTCGTAAACTGA
TGCAGGCTCGGAGCTTTGAAAAACACAAGGCTTTAAGGGT
AATTATTGCAGTTGTGGCTGTTTTTGTTTTCTCACAGTTG
CCGCTTAATGGATACCTTATTATAGAAGCAGGCCAAGCCA
ACAATGCCACAATTACAGACTGTGAAGTCATGCAAAGATT
AGATATGGTTGGGCAAATTGTGAAGAGTCTTGCTTACACA
CACTGTTGCTTGAATCCCATTCTGTATGTTTTTATTGGGG
TTCGTTTCCAGAAAGATCTCCTGAGCCTACTTCAGTGCAT
GTCATGTGGCTTAGGATCAGTTGAAAACTGTAAACTGCAA
GACACTAACAAGAAACCCTCTGTTATGTCTGACACCGACA
CAACTCCAGTTTTTTCTTTATAGATCATTGTTGATTTTAT
CAACAACTTTTATCCAAAAACTTCAACAGTGTCATTTGCC
ATGCTAAAGGTGTGATATACTTATTTTTTTAGTTTAGAAT
TGTGGAAAGACTATTAATTGTGCTTCATCATAGTATTCTT
CTTTTATAGTTTTCAGGCTCCTTTTTTGTAGGTGGAGTAT
CTTCCTGGGCATTTAACCAGTATTTTTTGGAAAATATGAT
TCTAGTTAGTGTACTGTTTTATGTATAATATTATGTTTTT
TTATGTATACACATCAGCGAAAATATTATAAAGTTTAAAT
ATATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations