Transcript

itga5-002

ID
ZDB-TSCRIPT-090929-9594
Name
itga5-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027005 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027005|OTTDARG00000021279|ZDB-GENE-031116-52 itga5|no_translation itga5-002 LG_none CR293512.7,CR678488.7,CT027694.11 Danio rerio protein_coding KNOWN, 676 bp
AAATATAGATTTTTTTCATTTTTGCAGACGTTGAAAGGCC
CCACAGAAATCCTGCTTTTGATAGTGCAGCTCAACATGAC
CTCACTCAGATGAATGGGAGAGGATGCGTTTGCATGTTTC
CACTTGTGTTTTTTGGATGGAATACAGGAAAGAAATGTTC
CACCATCCAGTAGATTCATTCTGTTGCCATGGCAGAGCAT
TATGGGGGATTCCTTTACTTTGTTTGCTGTGGAGAACTGT
ATTGTGACATTGAAAATAGTGTTGGACCATTTATGATAAA
TCAATTAATATGTACTTAATGTGCTTTTCAGAAAAGTTTA
TTACTTAGAGTTAATGAGATTTTATTAAAAAGAGTATTGT
TTTATTTTCAGCTATGGGCTGGTCTGCGGTTCACAGTACC
ACGTCTCAAGGACACACACAATTTTGTACAGTTTGACCTT
CAGATTCGTAGCAAGAATGAGAACAACTCTCAAAGTGAAG
TGGTCCCTTATAAGCTGGAGGTGGTGGTTCGCTCTGATGT
CATTCTGCAGGGCGTCTCCCGACCAGACAAGGTCTTCTTT
CCCCCTCCCAACTGGAAGCTGACCAAGAATGTGATGGTTG
AACAGAATGTGGGTCCCTCCGTCCAGCACACTTACGAGCT
GGTGAACAATGGGCCGAGTCGCATCAGTCACACTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations