Transcript

itga5-201

ID
ZDB-TSCRIPT-090929-9593
Name
itga5-201
Previous Names
  • itga5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027004 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027004|OTTDARG00000021279|ZDB-GENE-031116-52 itga5|OTTDARP00000022133 itga5-001 LG_none CR293512.7,CR678488.7,CT027694.11 Danio rerio protein_coding KNOWN, 5405 bp
ATTAAGCTGGAGGGAGGACGCAGAAAGGAGAGGACGGGAC
AGATAGACGGAGGCGCGGTAACAGAGCGCTTGGAAAAATA
AGGATCTGACTGATTCACTTCACCAAGGCATGAGATTTGC
GTAAGGCAGCAGCTTCAGCAGGATTCCGCTTAAGTGCATC
ACTTTTCTTGTGAAAGAAGTTTAATAAAGCAGTGGATTTT
GATACATCGGTTACTATGGGCTGCAAACGGCACCGTTCAA
AGACTTCGGCGTCTACAAGCTGCTCTCCAATGGGACTTTC
GTTGTTGATTCTTCTACCTTTGTCTGTTGCCTTCAACTTG
GATGTGGAGAATCCAGCGGTGTATAACGGACCCAGCGGTA
GCTACTTCGGGTACTCGGTGGACTTTTATATGACTGACTC
AAGTGTGAGCATTATAGTTGGAGCACCCAAAGCCAACACC
AGTCAGCCCAAGATCACAGAAGGAGGATCGGTCTTCTACT
GTCCGTGGAGTCTCAGCCAATCACAATGCAGCAGCATAGA
GTTCGATAGACTGGGAGATCTTAACATGTCCGTGAATGAC
ACAGACCATCAAGGAGAGTTCAAATCCCATCAGTGGTTTG
GAGCAACAGTACGAGTGCATCAAGACAGTGTGCTGGCTTG
TGCTCCTCTTTACTCGTGGAGAACCAAGGAGGACACTCCT
CATGCTGATACGACTGGCTCTTGTTTTATGTCTGTCAAAA
ACTTCACCAAGTTTGTGGAATATGCTCCGTGCCGCACAGA
ATTTCGTGGAAGGAAAGGGCAAGGCTACTGTCAAGGTGGA
TTCAGTGCTGATTTTACTCAGGAAGGAAAGGTGGTGCTGG
GAGGACCTGGCAGTTACTTCTGGCAAGGCCAAGTAATCAC
TGCGTTCAAACAAGAAATTGTCAAAGCCTATTACCCAGGA
TACTTCTTGACCTCAGTGGGTGGCCAGATCCAGACCAAAC
AGAGAAAAGAGATCAGATTTGATGACACCTACATGGGTTA
TTCAGTGGCTGTGGGCGAGTTTACCGGTGATGATGATGAA
GACTTTGTGACTGGAGTTCCCAGGGGAGTCAGACTGCATG
GACAGGTTTCCATTCTCAATAGCTCTCTGGATGTGCTGAA
GATGTTCACTGGTGAACAGATGGGGTCTTACTACGGCTAT
TCTGTGGCTGCCACTGACATTAACAATGACGGAATGATGG
ACCTGCTGGTTGGCGCTCCCATGTTCATGGTTCGTGACTC
TGATGGGAGGTTGGAGGAGTTGGGTCGAGTTTATGTGTAT
ATGCAAAAAGGTCCTCTGGATCTCATTCCTCAGCTACCTC
ACCTCACCGGCACACAAATGTTTGCCCGATTTGGGAGCTC
CATTACACCACTTGGAGACCTCAACCAAGATGGATACAAT
GATGTGGCCATCAGCAGTCCATTTGGTGGTGAAGACAAGC
AAGGGCTGGTGCTCATATATAATGGGAATGCTGGAGGACT
CAGGGAAAAGCCCTCTCAGGTGATCTCTGGACAATGGGCT
TCTGCCGGACTGTCAGCGATACCTGCTAGTTTTGGTTATG
CACTTCGCGGAGGCAAAGACCTAGATAACAATGGCTACCC
AGATCTCATTGTTGGGGCATTTGGTGCAGACAAAGCTGTT
CTTTACAGGTCCCGTCCTATTGTGAACACCAGTGCCATCT
TAAATGTCTACCCTATTATGATCAATCCTGAGGAGAAAGT
CTGCGCCATAAGCCGTGGGAATGAGACGCTGCATGTGTCC
TGTGTCAACTTAAGCTTCTGCCTTTCAGCCAATGGCAAGC
ACCTGCCAAATCATCTCGAGTTTAATGTGGAAGTTCAGCT
GGACCGTCTGAAGCAACAGCAGAAAGGGGCCGTACGGAGA
GCTCTGTTTTTAGAAACACAGCTCCCTGCTTTGCATCGGA
CGCTGACTGTGCCGAATGGAGCCAGAGTCTGCAGCGATAC
CAAGATCTACCTGCGGGATGAGAAGGACTTCAGGGATAAA
CTGTCTCCCATCTTCGTTGCTCTGAACTTCAGCCTGAATC
CTCAAGCAGCAGCAGACAGGCACGGACTGCAGCCCATCCT
CAACTACCAGACGGCAGAGCTCATTGAACAGAAAGCCCAG
ATTTTATTGGACTGCGGAGAGGACAACATCTGCGTCCCTG
ACCTGAAACTCTCTGTGCACGGGGACAGGAAGGAAGTGTA
CATGGGTGACGACAACTCTCTAACCCTGACTTTCAATGCG
AAAAACGACGGAGGCGGCGCTTACGAGGCAGAGCTGTATG
TGGTCCTACCACCAGAGGCCGACTACAGCGGAATAGCCCG
AAATAATGAGAGCCTGACCCAGCTGACCTGCAGTTACGAG
ACGGAAAATCAGACCCGTTACCTCAGCTGTGACCTGGGGA
ACCCCATGAAGTCGGGCACCAGCCTATGGGCTGGTCTGCG
GTTCACAGTACCACGTCTCAAGGACACACACAATTTTGTA
CAGTTTGACCTTCAGATTCGTAGCAAGAATGAGAACAACT
CTCAAAGTGAAGTGGTCCCTTATAAGCTGGAGGTGGTGGT
TCGCTCTGATGTCATTCTGCAGGGCGTCTCCCGACCAGAC
AAGGTCTTCTTTCCCCCTCCCAACTGGAAGCTGACCAAGA
ATGTGATGGTTGAACAGAATGTGGGTCCCTCCGTCCAGCA
CACTTACGAGCTGGTGAACAATGGGCCGAGTCGCATCAGT
CACACTTTACTGCAGCTCAAATGCCCCATGAGGCTTCACA
GTAACCGGTTCATTTACCCGCTGGAGGTCACCACGGAGGG
CCCGGTTAACTGCACCACCCACAACATCATCAACCCACTC
AACCTGAAGCTGCAGCAGTCTTCAACAGAGCAGCCTCCTG
TACGAGATTCAGGGCACGAACACCACATTGAGAAGCGGGA
CACGCACAAGGGAGAGCTCTCGCAACTGACCAATCTGTCT
TGCTCCAGTGTGGACTGTTGGACTCTGATGTGTAATGTTG
GCCTGTTGGAGCGAGGGACGAGTGCCATACTTCATGTTCG
CTCACGAATTTGGGCTGAAACGTTTATGGAGAACACTTAT
AAAAACTTTATTCTGGAGTGCCATGCTAGTTACAAAGTGG
AAAAGATGCCATATGCCATTTTGCCTAAGGTGACTCCTAG
TGGCTCTAAAAAGATGGTGACTCCTGTGGTGTGGAATAAG
CCGGACAGTTCGTACGCTGTTCCTCTGTGGATCATCATTC
TGGCGATTCTAGCTGGTCTTCTGCTGCTCGCGCTGCTCAT
CTACGTCCTCTACAAGCTCGGCTTCTTCAAGCGAACTCCA
TACGGCACTGCGATGGAAAAAGCCCAACTCAAACCTCAGG
CTGCATCCGAGGCCTAAACGAAGAGATGGTTCACGTCCTT
AACCAAAGGCCGTCCAAAGAGAAGCTGACTTGCTGTTGAA
AAGACAAAGACTAGACTGCAGTAGAGTAGACGGCGGAGGA
AAGATCACTGGATCTTCACTGTACTGCACTAGATAACGAG
ACCCTGAGGACTTAAAGCCAAATGAATGTTGACTTTGTTT
ATTTTAACTCGTTTTTTCCCCTTGATGTGGGTTTCCACTT
TTAACCACCACTTACAGCCTGCCGCTCACAAACAGTTTTG
GGTTGATCTGAACCAAAGCTCAGGATCACTGGCAACCTGC
TAAAGCAGAAAAAAAACAAAAAAAAAAACGGATTCAGCCC
AAGTTGGACTCAATCTGCACTAATGTAATTATGTTCGATT
TTTTTTTTTTAACAATTTCATGTCTTTTTTTTTTTTAGCC
CACAGCTGCTCAAGGTTAAACAATCCGCAGTGTAGCATTT
TCTATTTTTAGCATGCTATCTCACTAAAACACACCCTCAA
AGAACATCTATGCAGTATTTCACATCCAACCAAAGTTAAT
GATACAGGTTTTGCTGATTTATTGTGTCTTGCAAGCGAGA
ATGAGGTAGTCGGATACCTCACCAGGGACCCTCATCTCCA
TTTTCCTGCTGTCTATTTTGTTTATGAAGACATTTTAAAT
GTTTGTTTGTCACGTGACTTCTAATGGATAGAGTTTTCAC
TCTGAACGAGATGTTTTCAGCTCAGTCGCCTCATAGCAAG
CCAAGTTTCACTCTCAGGTGATGCCGCGTAAAGGATCAAG
TGGCGCTCTTTCAGTGGAAAACATTGTCAGGATCCTTTGC
GGAAGGCGACCGTTCTTCCCTACTGAATGTTAGCCGTTTG
CCTTAAAAGTCATCTGGGACAAAACTGGATCCGAGTCTGT
GAAACCTCACCGATGCCTTGAAGCAGAGCTGTGCTTTGCC
ATTACGCTAACAGACCCTCGGGCCAAAAGAGCAAAAACAA
TGTCATCACTCCAAACTTCTGTGGGCAAACGGAGACCCAC
TGTAGACTTGGATGGAGATTTACACAAAAACTCTTCCAAG
GCAGCAGGCCTCATCCAGGGACTGAATGTTGAAATACACC
TGTATACTTCTTGTCTTTTGTATGCGTGTTTGTGTTCTGC
TTGTGTGTATGGATGTGATTTTTTTTTTTTTCTTGGAGTG
CCACAGTCAGTAGAAATGCCTCCATACATCATGGTGCTGA
AGTGGTTGAGTGCGGGAATGAAATGAAAACTCCTGTTTCA
GCGAGCTGCCTAGAAGGCGACAGCAGCTGGAACCGTGGGA
TGCGTAGGAAATCTGTATGGAAGTGCAATATTCAACTTTT
TCTATGTGCATAATAATACTTTATTTTAGTGTCGCTCTCA
GAAATAAGGATTATTTGAAGACAACACCCAGTTTGAGGGT
TGAAATTAGCCCAGATTTAAGGTAATTAATGTAATGCTGT
AGGCTAAAACATACAGAAACACGGCTTCATCTGTCAAAGA
AGAATTATTTTTAATGGTTAAGTGTGATAATGCCATAAAA
TAGACATTTTAGACATTTTTTTGTCTGCCATATTGTAAAT
GCAGGTTTTACCAAACAAATGGGGTAGTTTGAATTGGTAC
ACAACCAAAGAAGCTGACACACAGACTCGACTTGAATCCT
TAGTAATGTTTTTAATGTATTTTGTACATTTTTACAAACA
AATATTTATTCCTCCAAAGTTAGATTTTAGTCTTGAGATT
TTTTTTGTTGTATTTTAAACAGGAGGAAACACTGGGTATG
TCTTCTTTTTTTGTTTATTTTCTTTTGCTTTTTTTTTTTA
CCAGCCCCAAATCTTGGTTTGTGTTTTTTTTTTTTTGCAT
TGAGTTGTAAATATGTTTGGTGAGGAGATTATTTTAATTT
TTCAGCTGATACTGATTTGACGTATTTCATCACCCCATAT
TGGGGAGAATCAGAGGGATGTTCAAGTAATTATTATTTGT
ATTTACAGTTTGCTTTTTAAAATAAATCTTTCATTTTTTT
GTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations