Transcript

l1camb-201

ID
ZDB-TSCRIPT-090929-9252
Name
l1camb-201
Previous Names
  • nadl1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026618 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026618|OTTDARG00000021065|ZDB-GENE-980526-512 nadl1.1|OTTDARP00000021836 nadl1.1-001 LG_ BX323461.27 Danio rerio protein_coding KNOWN, 4529 bp
TTCATTGGCCGAGGAGAACAGAGAGAAACACACACACACA
GAAGAACAGAGCAAGGCGTGTCCCGCACCATCCAGACCAA
CACACAGATTCACCTGCAGAGGATTGATCCAGACGCGAGC
CTGTCCCCCAGACGTCCTTCAGTCTGTGTGTGTGTCTGGA
GTCGGGGCTGTTTTCATGTTTGCTCCAGAATGCCTCCAGT
GCAGAGTCAGCCTGCAGGCAGAAGAGGACAGAAGCGCACT
CATCTTCATCTGCTGCTCCTCTTCCTCAGCGCGGCACAAA
CCCATGCATACATTCAGATCCCACACGACTACACATATAA
CAAGCTAAAACAGGCTCCAGAGTTCACGACTCAGCCCGTG
TCTCACACCGCTTTCTCCCTGGATGATGTTAATCTGGCCT
GTGAAGCCAGCGGAGACCCATCGCCCAGTTTTCGCTGGGT
CAAAGATGGAAAGCAGTTTGGGGAGGTTCTGTCAGAGTCT
GGAACTCTGACACCGCATCCAACAATGGACCTGCACTTCT
ATCAGGGCACATATCGCTGCTATGCTGCAAACGAGCTGGG
AACCGCCGTCTCTAACCTGGTGCATCTGACCACAGAGCCC
GTCCCAAGCTTGGCCAAAGTGAAGAAGCAAAAACGAAGAG
CGTATGAGGTGGGGGAAAGTGCAGTCCTCCGCTGTAACCC
TCCCAAGAGTTCTGTCACCCCGAAAATACATTGGATGGAC
ATGCAGTTTCACCACATTCCTCTGAATGAGCGAGTGACCA
TAAGCCGGGATGGAAATCTATATTTTGCCAATCTTATAGC
CAACGACAGCAGAGACGACTACACCTGTAATGCGCACTAC
ATCAACGCCAGCATCATCCTGCCTAAAGAGCCCATGTCCA
TCTACGTCACTCCCTCAAACTCTGTGGTGAAGAATCGACG
GGCGAAGCTGCACCACCCAGCCGGAGCCCGCAGCTCATAC
CTGGTGCTGAGGGGTCAAACACTGACCCTGGAGTGTATCC
CAGAAGGCCTGCCAACTCCAGAGGTGCACTGGGATAGAAT
AGACTCCGCTCTGTCTCCAAACCGCACCAAGAAGCTGTAC
AACAACCGCTGGCTGCAGATAGACAATGTGCTGGAGTCTG
ATGATGGAGAGTACGTCTGCACTGCCAGAAACAGCGAGAA
CTCCGTCAAACACCACTACACTGTCACAGTAGAGGCTGCT
CCATACTGGACCCGGAGGCCTGAAGAGCATCTGTATGCCC
CGGGAGAGACGGTCAGACTGGACTGTCAGGCCGACGGTAT
CCCTGCCCCGAACATCACATGGAGCATCAATGGAGTTCCT
GTTTCAGGCACGGATGTGGACCCGAGACGGCGTGTGAGTT
CTGGGAAACTGATCCTGTCCAATGTGGAGTTCAGCGATAC
GGCAGTGTATCAGTGCGAGGCTGTCAACAAACACGGAAGC
ATCCTGATCAACACACACGTGCATGTTGTTGAACTGCCAG
CTCAGATCCTGACCCCAGATGAGCGCCTCTATCAGGCCAC
TGCAGGACAGACTGTAATGTTGGACTGCAGAACGTTCGGG
TCGCCGCTGCCCAAAATACACTGGGAGATTCTAGACTCTA
TTCCAGCTCTGTCCAATGCTAAAATATCTCAGATGACCAA
CGGAAGTCTTAAGATCAGTAATGTGAGTGAAGAAGACAGC
AACAGATACACATGTTCAGTGAGCGAAACCAACAAGAGCA
TCAGTGCGGAGCTAGAGGTCCTGAACAGAACAAAGATTGT
TGGACCTCCCCAAAATCTCCATGTTATACGTGGAAGTGAT
GCGATTTTACACTGCAAATACACAGTGGACCACAACTTAA
AATCCCCCACGGTTCAGTGGAAAAAGGATGGACACAAGAT
CACAGCATCTACAAGCAATGACAAATACCATGAAATCGAA
GGCTCTCTGAAGGTCTGGGATGTTCAGATGGAGGATATGG
GCATCTACAGCTGTGAGGTCAGCACTACACTGGACTCAGA
CACTGCCAGCGGATACATCACTGTTCAGGATAAACCTGAT
CCTCCTCAATCTCTGAAGCTGTCTGAAAAGATGGAGCGTA
GCGTGACCATCTCCTGGATGCCGAGCGTCGAAAACAACAG
TCCTGTTACGGAGTATGTGATTGAGATGAACGAGGGGGAG
ACTCCAGACGAGGGTCAATGGCAGAAATACAGGAGTGTTT
CTCAGGACATCCGACAGCTGGAGATCCACCTGCAGCCCTA
CAGCAAATACCACTTCCAGATCCGGGCAGTGAACAGCATA
GGAACCAGTGCTCCCAGCGAGTCCTCGCTCTCCTACAGCA
CTCCAGCAGCCAAACCGGACACGAACCCAGAGAATGTGAT
GACCCTGTCCACTGACCCAAAGAGTATGATCATCTCATGG
CAGGAGATGGATCGGCGTCAGTTTAACGGGCCGGGGTTCC
AGTATAAGGTGTTCTGGCGTCGAGCAGCAGACAGCGGTGC
ACACTGGACAGAGAGCAGCGTCTCCAATCCTCCACTGATG
GTCAATAACACCGGAACATTCGTCTCCTTTGAGATTAAAG
TTCAGGCCGTCAATGATCTTGGTGCTGCCCCAGAACCGCT
CACTGTGATCGGCTACTCCGGGGAAGACTTTCCTCTGGAG
GCTCCGTCAGCGTTGTCTGTCACTGAGCTGCAAAAAACTT
CTGTGATGGTGAGATGGAGTCCAGTCAGGCCGGAGTCTGT
CCGGGGACACCTACTGGGATACAAGATCTATTTGAGAATG
AAGGGTCCCAGTGGGAGACTCCGGGCCGGGCGGTCTCCAG
CAGTGGGTAATCCCACAGTGATAGAGGTCCCTGCAGACGC
GGCAGAGAAGATCGTGAGCGACCTGCAGTATTACTCAGAT
TATACTCTGACCATCACTGCGTTCAACAGCAAAGGTGAAG
GTCCACATTCAGAGGAGAGCAGCTTCAGCACTCCGGAGGG
CGCTCCCGGACCCGTGTTATTCCTGCCCTTCGACAGCCCG
TCTGAGAGCGAGATCACCCTGCGCTGGGAAGCACCACACA
AACCCAACGGGGAGATCAGAGGATACCTGCTGCAGTACCA
GGAGGTTGTGACTGGCAGTGAGAGCCCACAGCATGTGGAG
TCCATCGATCTGCCGGCGGTGACGGAGTTCACACTGAAGA
ATCTGAATCCGGAGAGCCGCTACACCTTCCACCTCAGTGC
CCGAAACAGTGCCGGCGATGGGGCTCCGGCCATACAGAGC
GGCGCCACCCTGCTGGACGGAGAACCTCCATCTGTAATCA
ACATGACAGCTGGAGAAACCTCCGTCAACCTCAGCTGGGT
TCCTGGAGACCGACATCGAAACGTTGGCTTTAGTTTCCGT
TACCTGAAAAAAATAGAGGGTGCTGAATGGGAAGAGTCGG
AGAAGATCAACTCCACACAGGCCTTCTATCAGCTGCAGGG
TCTGGATTCAGGCGTTATTTACCATCTGCAGGTCCTGTCC
GGAAACACTTCTTATGACTGGGATTTCAAAACGATATACA
GGCGAGAGTTGCACAAGTCGCCTAGCAACTTTGCGACGGA
GGGCTGGTTCATTGGTCTGATCAGCGCTCTGGTTCTGCTG
CTGCTGGTTCTGCTCCTCCTCTGCTACATCAAGAAGAGCA
AAGGAGGGAAATATTCAGTGAAAGATAAAGAGGAGGGTCA
GGGGGACGCAGCAAACCAAAAACTGAAGGATGACGCCTTC
GGAGAGTACAGATCTCTGGAGAGTGATATGGAGAAGTGCT
CCATCAGCCAGCCGTCGGGGTGCGAGAGCAAGCGCAGCAG
CAACGACAGTCTGGCGGATTACGGGGACAGCGTGGACATC
CAGTTCAATGAGGACGGCTCCTTCATCGGGCAGTACAGCG
GTCGAAGGGATCCACGCGGGCACGACAGCTCTGGCGCCGT
GTCGCCGGTCAACCCCAACATGCCTCCGCCCAGCCACAGC
TTCCCCACCTCCGTCACCGGGATCCTGGGGCCTAATTAAT
GATGCATCATGGGCCCTTGAGGGACTTTAGACAGGATAAC
GATTTCAGGACGGTCATGATTAAAAGTCGTCATCTGCAGA
CACTCACACATCGACACACACTCATTCCACAGAACGATTT
CTCGTAACATTCCACCCTGAACACTGTTTACAGCGCCCAT
TCCTCTGAGTCCTCACCCGCTGTAGGGATCGGGGTCCTGC
TGGGTGTTGCCGCAGCCGGTTCAGCATTTAAGCTCATTGC
ACACTGATGCCGAAATGTCCATGTTCAAAAATACATCTAA
CCTCAGGTTGTGTCAGTCGCATTGACACACTGCCTACGAA
ACTTTCATCGGTTTTCAATCAGGCGGAAGGCAAAATCCAT
CAGACCGTCACTCGCAGTACAGATCACTTCAAGACAAACA
CAGTGTGTGAAATAAAGACAGAGTGTGTAGGATGGTTGAG
AAACACTGCTGTAGACAACTGTTTGTGCGCATGTGCGTGT
GTGTGCTTGCATGTGTGTGTGTGAGTCTGCCAGTCTCTGT
TTAGAATTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations