Transcript

thrab-201

ID
ZDB-TSCRIPT-090929-8622
Name
thrab-201
Previous Names
  • thrab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025918 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025918|OTTDARG00000020654|ZDB-GENE-060613-1 thrab|OTTDARP00000021294 thrab-001 LG_none BX510316.11,CR753833.17,CU457798.9 Danio rerio protein_coding KNOWN, 1831 bp
GTGAAACTGGGGAGGGAGGAGCGATAGTAGTATTTCTCTT
CATTTCAAATCCCTGTCGTGGCAGCACGGGGCAAGGCAGA
GGACTTTTCTCCCCTAAAACTAAGGGGAAAACCCACCACC
GAGATCTCAGTGCACGTCCTAAAGAGCAAACGGAGGTCTT
TGGGAGGAGGAAACAGTAGTTTGAAGGCACGCTGCGGTGG
GATCGGCTGACTGTGTGCACTAGTGTCTCTCCACACTTGC
ACTGGATACACGAAGCAGGACGTTTTCACTTATCTACCAC
TGGCAGGATCCCCGCGATCTCCCCAAAACCCCGCCAAACA
TCCAGTCGGGCAGCGGCCTGTAGTTCCAGTCATCCCAGGC
CTACGGACAACAGTAAACCGAAGCAAAGCACAACAGGACA
CTGAGCTCATCCCATATTGCGTCACTGGCCATCTGTGTTT
GAGAGTGAGGCGGGCCTGGTTTGTGAGCGTCGCTCCACAG
AGCCGTCCCATGACTGTCTGACTCATCACAACCCGCGAAT
GACAGGCGTGCATTCGAGGGTGGGGCCCGCCTCAGTCTCA
CATGATTGGCTGCTGGATGGAAATAAGGTGAATGGAACAC
ATGCCCAAGGAGCAGGACCCAAATCAATCAGAGGGAGAAG
AGAAACGGTGGCTCGATGGCCCGAAAAGGAAGAGAAAGAA
CAGCCAGTGTTCGGTGAAGAGCATGTCAGGGTACATCCCC
AGCTATCTGGAGAAGGATGAGCCGTGTGTGGTGTGTGGAG
ACAAAGCTACCGGATATCACTACCGGTGCATAACCTGCGA
GGGCTGTAAGGGATTTTTCAGGCGCACCATCCAGAAAAAC
CTTCATCCCTCTTATTCCTGTAAATACGATGGCTGCTGCA
TTATTGACAAGATCACCCGCAACCAGTGCCAGCTGTGCCG
CTTCAAGAAATGCATTGCCGTGGGAATGGCCATGGATTTG
GTACTGGACGACAGCAAGCGGGTCGCGAAGCGGCGCTTAA
TTGAGGAGAACCGTGAGAAGCGGAAGAAGGAGGAGATGGT
GAAGACTCTGCAGAATCGGCCAGAACCCACTAGCTCAGAG
TGGGAGCTGATCCGTGTCGTAACAGAAGCGCATCGCCACA
CCAATGCACAGGGCTCGCACTGGAAACAGAAGCGCAAGTT
CCTGCCAGAGGATATTGGACAGTCTCCGGTGGCCCCCACA
TCAGATGGGGACAAAGTGGATTTGGAGGCCTTCAGTGAGT
TCACCAAGATCATCACCCCAGCCATCACACGCGTCGTCGA
CTTTGCCAAAAAACTGCCCATGTTTTCAGAGCTGCCTTGT
GAGGATCAGATCATCTTGCTGAAGGGCTGCTGTATGGAGA
TCATGTCTCTGCGTGCTGCAGTTCGCTATGACCCAGAAAG
CGAGACCTTGACCCTGAGCGGAGAGATGGCTGTCAAACGA
GAGCAGCTCAAGAATGGAGGGCTGGGCGTTGTGTCTGATG
CCATCTTCGACTTGGGCAAGAGTCTGGCGCAGTTCAACCT
GGATGACACAGAAGTGGCGCTGCTGCAAGCTGTACTGCTC
ATGAGCTCAGATCGTACAGGTCTGACGTGTGTGGAGAAGA
TCGAGAAGTGCCAGGAGATGTACCTCTTAGCATTCGAACA
CTACATCAACTATCGCAAGCACAACATTCCTCATTTCTGG
CCCAAGCTGCTGATGAAGGTGACGGACCTGCGGATGATCG
GAGCCTGCCACGCCAGTCGCTTCCTGCACATGAAGGTGGA
ATGCCCCACTGAACTCTTTCCCCCACTTTTCCTGGAGGTC
TTCGAGGATCAGGACGTGTGACGTCCCGGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations