Transcript

nr1i2-202

ID
ZDB-TSCRIPT-090929-8200
Name
nr1i2-202
Previous Names
  • nr1i2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025462 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025462|OTTDARG00000020381|ZDB-GENE-030903-3 nr1i2|OTTDARP00000020947 nr1i2-001 LG_ CR848676.7 Danio rerio protein_coding KNOWN, 2502 bp
GGACAGATCGTGAAATTAGGTAAATAGGCAACGGCAGCAT
TCGCGTCCATATCACAGAGGACGTGTTTTCTCGTTTCCCT
GTCAAGCGTGTCCTTCTTCTCGGGACATCTGTAACCAGGA
AGTGGAGCCCTAGTTAGTCCTCGATCAGTTGTTTGTACAA
TGCGCGCTTAAAAATCAGGACTGTAACTCTGTGTTCGTGA
TAAGAGATCGTGTCATGGCGCATGTCGGAGCTCGCCGTGT
CTGCTCGTGATGAGGCAGTACGTCAATGTCCCGCTTATAT
GACATGTGCTTACTTCAGCTCAGGATGAGTAAAGAAATGG
AGGAGCTTTCTCCCCTGGACGATTCGGGACACGGTGATGG
GTCTGAGGAGGAAACAGAGGAGGATGACGAACCTAAAATT
TGCCAAGTATGCGGCGACAAATCTACTGGCTATCACTTTA
ATGCCATGACCTGTGAGGGCTGCAAAGGCTTTTTCAGACG
TGCGATGAAGCGACCGGCCCAGCTCTGCTGCCCATTTCAG
AGCGCCTGTGTCATCACCAAGAGCAACAGAAGACAGTGCC
AATCCTGCCGGCTTCAGAAGTGCCTCTCAATAGGCATGAA
GAGAGAGCTGATCATGTCGGATGAGGCGGTGGAGAAGCGG
AGGTTGCAGATCAGGAGGAAGAGGATGCAGGAAGAGCCTG
TAACTCTCACTCCTCAACAGGAAGCTGTCATACAAGAGCT
GCTCAACGCACACAAGAAAACCTTCGACATGACTTGTGCC
CATTTCAGTCAGTTCCGGCCTTTAGATCGGGGTCAGAAGT
CTGTGTCCGAGTCCATTCCAGTCACAAACGGCAGCTGGAT
CGATCACAGACCCATCGCTGAAGACCCAGTGCAGTGGGTC
TTCAACTCCACTTCGCTCTCGTCCTCTTCCTCCAGCTGCC
AGAGCCTTGACAAAGAGAAGAAGCACTTTAAAAGTGGCAG
CTTCACCTCTCTGCCACACTTCACAGACCTCACCACGTAC
ATGATCAAGAATGTCATCAACTTCGGGAAGACGCTGACAA
TGTTCAGGGCTCTGGTTATGGAGGACCAGATCTCGCTGCT
GAAAGGTGCCACCTTTGAGATCATTCTGATTCACTTCAAC
ATGTTCTTTAATGAAGTGACGGGAATTTGGGAGTGCGGCC
CCCTGCAGTACTGCATGGATGATGCCTTTCGAGCTGGTTT
TCAGCACCATCTGCTGGACCCAATGATGAATTTCCATTAC
ACACTGCGTAAGCTGCGTTTGCATGAGGAGGAGTATGTGC
TGATGCAGGCCCTCTCTCTCTTTTCACCAGATCGCCCTGG
TGTGACAGACCACAAAGTGATCGACCGCAACCAGGAAACA
CTAGCGCTCACCCTAAAGACTTACATTGAGGCCAAGAGAA
ATGGGCCAGAAAAAAATCTGCTGTTCCCAAAGATCATGGG
GTGCCTGACCGAGATGAGGAGCATGAACGAAGAGTACACC
AAACAAGTGCTGAAAATCCAGGACATGCAGCCTGAAGTGT
CTCCACTTTGGTTGGAAATAATAAGCAAAGACACCTAAGT
CCTCACAAAGCACGTGCAACTCTACTTATTCCCAACTACA
ACACTATTGCTGACCTTCATCCGAGGACATTCAAAACCGA
AAGACTAGCAATGGCAGGGACTGTACCTGCTGAAAATGAA
CTGCTGAACAGCGCACACTGTGTGGACAAATAGTTTTATA
TTGGAGTTACTTAGTGTAATTGTGTTTGAGGATGTCCCAC
TGCCAATCGTTTTCATCGTTTCACAAAAGAACATTTTCTA
TGGTTCGTAACCACATATGATCTCTTATGTTAACTTCTTG
AATGGAGCTTGACGTTTGGGGTTTAACTAAGCTTGGATTG
GAAATGTACCACTTTTTCATGGTAACACTTTACGATGAGG
TTCTGTTTGTAAAAATCAGCTAACATTGCTACACTGTAAA
ACTGAATAAGTTAAGGTAGCTCAAACCATGCAACAAACCA
TTTACATTCAAAAACTAATCCTAATGAGTACAGTGAACTT
AATCCATTTGAGTAAACAAAGCAATTTGAGCACAGTGAGG
CCCAATAAATGAAGAGAACTCAAACCTACTGAGTACTGTA
ATACCCAAGAAGTTAAGGCAACTCAAAATGTTTAAGGAAA
CCATTTAAGTTAAACTAATCTATACGAGCACTGTGAACTT
CCTCCATTAACGTTGAAGTAATGAGGTATTTGAATTACTC
ATTACCTTTAACACAAGAGTTATAAACTCTTTTCAAATGA
GTAGAATTAACTTTCAGTAAGTTTTGAGTTAACTACACTC
ATTTCATTTGATGAAGAGGACTGTTGGGTTCTACAGTGTA
ACAGTAGGTAGGGTATTGTGGCCAGATCAGGTCTGGGCCA
GACAGAATTTGCTCATATGTCTTGCTATATCTGGGGGGAA
TAAGCTATTTATGCAGAATTTGAGATTATATTAACTAAAA
ACTTAAGGCATAAAATAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations