Transcript

gjd2b-201

ID
ZDB-TSCRIPT-090929-4849
Name
gjd2b-201
Previous Names
  • cx35-001
  • gjd2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020704 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020704|OTTDARG00000017183|ZDB-GENE-030911-1 cx35b|OTTDARP00000017495 cx35-001 LG_ AL645822.24 Danio rerio protein_coding KNOWN, 3259 bp
GATTTCACACGGTTCTCTGTGTTACATTCGCCTCCGAATG
AACAGCCATGGGGGAATGGACAATTCTCGAGCGTCTCCTG
GAGGCGGCTGTCCAACAGCACTCTACTATGATTGGGAGGA
TCCTGCTAACTGTTGTGGTGATCTTCCGGATTCTAATTGT
GGCGATTGTTGGAGAGACCGTGTACGACGACGAGCAGTCA
ATGTTTGTGTGTAACACTCTGCAGCCAGGCTGTAACCAAG
CTTGCTATGACAAAGCGTTCCCTATATCTCACATCAGATA
CTGGGTTTTCCAGATCATCATGGTTTGCACACCCAGTCTC
TGCTTCATCACATACTCTGTGCATCAGTCGGCCAAACAGA
AGGAGCGGAGGTATTCTACCATCTACCTGTCCCTCGACAA
AGACCCCGATACGATGAGGCGAGACGACAGCAAAAAGATC
AAAAACACCATTGTGAACGGAGTACTTCAAAACACGGAGA
ACTCCACCAAAGAGTCCGAGCCTGACTGTCTAGAGGTCAA
AGAGATCCCCAATTCAGCCATGAGAACTACCAAATCTAAA
ATGAGAAGACAAGAGGGCATCTCCAGGTTTTACATCATTC
AGGTGGTGTTCAGAAACGCACTGGAAATTGGCTTCCTGGT
GGGCCAGTATTTCTTGTACGGATTCAACGTGCCCGCCGTG
TACGAGTGCGACCGCTATCCTTGCATCAAAGACGTCGAAT
GCTACGTATCAAGACCTACGGAGAAAACCGTGTTCCTCGT
CTTCATGTTTGCAGTCAGTGGGATTTGCGTGGTGCTCAAC
CTGGCTGAACTCAATCACCTGGGCTGGAGGAAAATTAAAA
CAGCGGTGAGGGGGGTTCAGGCCAGGAGGAAGTCCATCTA
TGAGATCAGAAACAAGGACTTACCGCGGATGAGCATGCCG
AATTTCGGAAGAACCCAGTCCAGTGACTCTGCCTACGTTT
AATGCTTTCTTCGTGTAGATTATTAGAGTGGTGGTCCTCA
ATTCTGGTTCAGAAAGAGCACAGGTTGCACATTTTGGATA
TGTTCACCCCACCTTATGTAGCTTATTCTGCAATACGGAA
GTAAGCCTTTTTTTGTGATTGTTTTGGAACTTCCGATTCA
TTTGCTATACGGGAAATGACTAGGAACAATAAACAACAGT
AAATGATCACAATACTTGCTCTACAAGCAATGTTTAAACA
AAATGTTTAAAAAAAAAATTAATAAGAAAATAGTTTGCAA
ACATCAAGTTTGCAACATCAAGTAGCATAATAAGCTATTT
TCTATGGCTAAAAACAATGGAAGTGAATAGGACTGGAAGT
CTCGTGCCTATAAGGTTCTAATGGCTGGGCCCACATTTAC
AGCGCTCAGCATAATTAAGTACACCTCTATTAAGTTTCTT
CTATTAAGCACCTCTATTATTATTAAGTACACTTCATTTT
AGAAAATGAATATTTGTATCCATTTCTCAGTGAACATAGG
CAATGTATTTTGATGCGTTAAAACAAAACAGATTTATTAA
ACAGACATATTTATTAAAATATTTTTTCAGTCACCAAACA
TATTAGAAATTGAATGATAAAACAATTCAGATAAAATATT
GCAAAAATAACTTACAACCTACAAAATTTGTACATTTTTT
TGCTGCTCTTGATTTTTCCTCCTTGATTTTGACCGTTATC
GTAGGTTATTGTGATAGATTGGCTCCAGATTTAGCTTCAG
TATTGACTAATCTAATGTATATGCACAAATGTATTATTGT
AAAATTTTATTTTGATTTTATTTTATATTAATTTAAAAGA
TGGATTTGTGAGGGGTGAACTTATATATGCTGAGCACCGT
AAGTGAAAAAAATAAGCTCAATAGAAAACCACAGCGACTT
CACATGTGCAACCAACCACATGGAACGTGTGGTTTTGGAA
CATTTTCATGTGTAAAGAAATGTGTATAACATGATTGGTG
TGTTGTACATATGATTTTAATGTGAAACTCTGCCATGAAA
CTCCCTATCAAGTTATTCCAAGCCTTTATGTCCTTCTTTG
GAACACAAAAGCAAATGTTTGCAAAATGTTTTTGTCCATG
CAATGGGAACTCTTGTCAAAAACAACATTGGATCTCTCAA
AATATCTTGTATTTGTGTTCCATGGAAAGACATTAGTGTA
AGCAAATGATGCCAGTGGCATCCAAAATGTGCATTTCTTG
AGGACACCACTAGATTAGATTATATTAAGACCAGATACTT
TATGAACTGTTCATCTCGCCTGTTTGATGGTGGGGTAGAT
GGATTTTATTTGTCTTTTATGGACAAACTGAACAAACGGA
CCAAACAAACGTTTGTTTCCTATCATTTACTGAAGGGCAC
TGATGCAACTTTTTTTATCGGTCGGAACGGAAAAGCTTAC
GATGACATTATTTCGATATTTTATTTCTTCGTTCACACGA
TCAGCTGAACTCGAAATATGTTTTGCACTAAATACGGATT
TAATGAAGCCAAAATGAACCCAAACTGTGCTGTGACGGTT
TTTACATTTCATTATCTTGTATTTCATTCTGGTTTTAGAT
TGCACTTACAGGTTTTAGTTTTTTTCACTGCAAGTAGACT
GCAGATCTAATATGTTTATCAATACTATATTCATATCTCT
CTCTTTCGGCTTAGATAGATTGGCATCTTTAATGATTTGG
TTGCCTGTGCTTGCACCACTGACCTTAACATAAGTTATTG
TTTTGTTATATATATAAGCTGATTTGCAGATCAGTAGCCG
GTGAACTGGCCTATGCTGCATAACGCTGAACTCTCTATCT
TTTTTATTTATTTCTTAGTATATTGGACTGTTTTATTGAT
TTATTTATGTTTGACACCAAAGCGCCCATTGCTTTCATTT
GTGGGAATCGGATATATTGCTTTTATGTATTCAAGTGCCA
TATATGTACATAGATATATACATATTATAGAATATTGTAA
TCCTTATTGTGAGGTATGAATTCTATATGCGTGGACTGCT
TAAAAGGATGTTCCATCCCTTTAATGTGAGAATGGAAGAG
TGAAAAAAATCATTCATACATATTTTGCATTCATGAAAAG
TATAATATTGCATTTAAATATATAGAAAGCACAATTGATA
AGAAACCAGTGATTACGGGGTTGAGATTCACTTCCCCTGG
TGCTTCAATTTCTCAAAAAACATGATGTTACAGTAGCAAC
TATGTGAGAATTTAAAAAAAAAAAAATCCAACAATAAATG
ACAGAATTCATGACTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations