Transcript

rarga-202

ID
ZDB-TSCRIPT-090929-4542
Name
rarga-202
Previous Names
  • rarga-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019701 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019701|OTTDARG00000016394|ZDB-GENE-980526-531 rarga|OTTDARP00000022098 rarg-002 LG_none BX546466.6,BX465864.12 Danio rerio protein_coding KNOWN, 666 bp
AGTGTAGTGTGAAAGAGACTCTGATGAACGGAGCGCGCGT
GCTTCTCTTCTCTTCTTTTCTTCTCCTCTCGCGGATTTCA
GTCACAACGGGCACATACAAGTGAACACGGAGCCGTGACG
CAGATTGGTGAAGTTTGCCAACATTGTGACACAGGCTGTT
GAAGCACACAACTGGCCCGACCAGCCTTTGGCAACCAACT
GTCACCATGGCAACCAATCGGGAACGGCAGGTGGGTCACA
TGACAGGCTTCCCACCTGCTGTCTACCCCTTTGCCTTCAA
TTCCATGAGGAGCCACTCCCCTTTCGACCTGCTGGCCAAT
AGCAATCTATTTGGGCGATTTGGGGCGGACCTTCCCAAAG
AAATGGCAGCTCTGTCGGTGGAGACTCAGAGCACCAGTTC
GGAGGAGATGGTGCCCAGTTCCCCTTCCCCGCCACCTCCA
CCGCGTGTTTACAAACCCTGCTTCGTCTGCCAGGACAAGT
CTTCTGGGTACCACTATGGTGTCAGTTCTTGCGAGGGCTG
CAAGGGTTTCTTCCGTCGCAGTATTCAGAAGAACATGGTG
TACACCTGCCACCGTGACAAGAACTGCCAGATCAACAAGG
TCACGCGCAACCGTTGCCAGTACTGCCGGCTGCAGAAGTG
CTTCGAGGTTGGCATGTCCAAGGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations