Transcript

rarga-201

ID
ZDB-TSCRIPT-090929-4541
Name
rarga-201
Previous Names
  • rarga-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019700|OTTDARG00000016394|ZDB-GENE-980526-531 rarga|OTTDARP00000016646 rarg-001 LG_none BX546466.6,BX465864.12 Danio rerio protein_coding KNOWN, 2053 bp
GCTAGGAACAGCTCACCCCGAGCAGGCAGCACCGCAGATC
AGCCGGAGAGAGGGAAAGAGAAACAAGCAGCGTGAGAGAG
CGAGAAGGAAACGCTTACAAGAGCAAAAGCAGCAGGATCA
GGCAGCACGTATATCCTGACTAGAGGAATTCCAGCAGGGA
ATTTAGCACTGTCGTAGCTGCGGGTGTTGTTATTGTTGTT
TTTGGTGACGAGAGGCAATCGGAGGCGGGTGGGTGACCGG
GACGCAGCATGTTCGACTGTATGGAGGCTCTGGGCATGGG
TCCCCGCCAACTGTACGATGTCACCAACCGGGGAGCATGC
ATGCTTCGGAAGGCGAGTCCTTTCTATGCTGGACTGGACC
CTTTTGCTTGGACCGGGACAGCCAGCGTACGCTCGGTGGA
GACTCAGAGCACCAGTTCGGAGGAGATGGTGCCCAGTTCC
CCTTCCCCGCCACCTCCACCGCGTGTTTACAAACCCTGCT
TCGTCTGCCAGGACAAGTCTTCTGGGTACCACTATGGTGT
CAGTTCTTGCGAGGGCTGCAAGGGTTTCTTCCGTCGCAGT
ATTCAGAAGAACATGGTGTACACCTGCCACCGTGACAAGA
ACTGCCAGATCAACAAGGTCACGCGCAACCGTTGCCAGTA
CTGCCGGCTGCAGAAGTGCTTCGAGGTTGGCATGTCCAAG
GAAGCTGTGCGCAACGATCGAAATAAGAAGAAGAAAGACG
TGAAGGATGAGGTCATTCCGCCAGAGAGCTATGAGCTGAG
TGGGGAACTGGAGGAGCTGGTCAACAAAGTGAGCAAAGCA
CATCAAGAGACCTTCCCTTCACTCTGCCAGCTGGGAAAAT
ACACCACAAACTCCAGCTCGGACCACAGGATTCAGCTAGA
CCTGGGCCTATGGGACAAATTCAGTGAGCTTTCCACCAAG
TGCATCATTAAAATTGTGGAGTTTGCCAAACGCCTCCCAG
GCTTCACCACCCTCACCATCGCAGATCAGATCACCCTTCT
CAAATCTGCCTGCTTGGACATTCTAATGCTGCGAATCTGT
ACACGATACACACCGGAGCAGGACACAATGACCTTTTCGG
ATGGACTAACCCTCAACCGGACTCAGATGCATAATGCAGG
TTTCGGACCGCTCACTGACCTGGTGTTTGCCTTCGCTGGT
CAGCTTCTGCCTCTTGAGATGGATGATACGGAGACTGGCC
TCCTTAGTGCCATCTGCCTCATATGTGGAGACCGAATGGA
TCTTGAGGAGCCAGAGCGTGTCGATCGTCTGCAGGAGCCC
TTGTTGGAAGCTCTGAAGATTTATGCACGACGCCGCCGAC
CCAACAAACCTCACATGTTCCCTCGCATGCTGATGAAGAT
CACTGATCTACGTGGGATCAGCACCAAGGGAGCGGAGAGG
GCCATAACTCTGAAGATGGAGATCCCGGGCCCCATGCCTC
CTCTCATCCGAGAGATGCTGGAAAACCCAGAAGCCTTCGA
GGATCAGAGCGAGTCCACAGAGAAGAAGCCGGAGCCCGAA
CCGCCAGCTCCTCCTCCACCCGCCCTGCTCACGATGAAGA
AAGAGCAAGAAGATGAAGACGACAGCTGGGCCACAGAGAA
CGGCAGCGAGCCTTCACCAGAAGAGGAGGATGACGATGAT
GAGGACGGAGAGGAGGAGAGGGGTACAGACAGCGATGGAG
AGGCCTGGGGGGGACAGGAACCCAACGCGGATGTGTCTAG
AAAGAGCCACGGAGGAAGAGCTCAGTGAGCGAGCTTCTTC
TTCCAGGGCAAACGCAGAGCCTTACCTGTACAGACAGACA
GTGCTAACTCAGGCCACTCGGTCAACGATGAGAGACATCA
GTGAGGAAACTCACGTAAAAAAAAAACCTCTTCTCAGGAC
CTCTCCCGCAGAAAGAGAGGGAAGGCGAAAGACAAAACAA
CTGGCTTTTCAGACTAAATAACTGCCGCTTTTATAAAACG
TGTTTGTTTGCTTTGAAAAGGAGAAGCCAAATGGACTTTT
AACAGTGTACTTTCAACGGGTTCAAACAAAAAAAACAAAC
AAAAAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations