Transcript

ottdart00000001875

ID
ZDB-TSCRIPT-090929-23220
Name
ottdart00000001875
Previous Names
  • busm1-256p4.1-001
  • dZ256P4.1-001
  • mycbp2-001
  • si:busm1-256p4.1-001
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001875 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001875|OTTDARG00000001756|ZDB-GENE-030616-132 mycbp2|OTTDARP00000018927 BUSM1-256P4.1-001 LG_ AL731656.5 Danio rerio protein_coding NOVEL, 2743 bp
ATCTACTATACTGGAAAGTATCAGAGCCTCGGTATCAAAC
AGGGCGGACCATCGTCTGGGAAGTGGGTGGAGTTGCCTGT
CACCAAATCACCCAAGATTGTGCAGTTCTCAGTGGGACAT
GACGGCTCCCACGCCCTGCTGGTGGCGGAGGATGGGAGCG
TCTTCTTCACAGGCTCCGCCAGCAAAGGGGAGGACGGAGA
GTCAACAAAGAGCAGAAGACAACCAAAGCCCTACAAACCC
AAGAAGATGATCAAACTCGAAACCAAGATGGCCGTTTACA
CAGCCTGCAACAACGGCAGTAGCAGCATCGTCACTAAAGA
TGGAGAGCTCTACATGTTTGGCAAGGATGCCATTTACAGT
GACAGTACCTGCCAGGTATCAGATTTGAAGGGACACTTTG
TAACTCAGGTAGCCATGGGAAAAGCTCACACCTGTGTCCT
GACCAAGAGCGGGGAGGTTTGGACATTTGGAGTGAACAAC
AAAGGCCAGTGTGGTCGAGACACTGGAGCTATGAGCCAGG
CAGGGAAAGCGTTTGGAGTGGAGAACATGGCCACCGCTAT
GGACGAGGACCTGGAGGACGAGCTGGACGAGAAGGAGGAA
AAGTCTATGATGTGTCAGCCTGGCATGCACAAGTGGAAGC
TGGACCAGTGTATGGTGTGCACTGTGTGTGGAGACTGCAC
TGGATATGGGGCCAGCTGTGTGAGCAGTGGCCGACCTGAC
AGAGTGCCAGGAGGGATCTGTGGCTGTGGCTCTGGCGAGT
CGGGCTGTTCGTCATGTGGCTGCTGTAAGGCTTGTGCCAG
AGAGCTGGATGGTCAGGAAGCCAGACAGAGAGGAATCTTT
GATGCTGTGAAGGAAATGATACCGCTGGACCTGCTGTTAG
GTACATCCAGAGGTGTCATCCAATCACGTTCACTCCAGCT
TCATAGCCGCGTCAATATAGAGGAGCACATCCAGATTCGA
CAGGAGGAGAAGAGACAGCGCATCAACCGCCGCCACCGGC
TGGAGGAGGGCCGAGGCCCCCTTGTTTTCCCTGGTCCCCT
TTTTATGAACCAGCGTGAGCAGGTGCTAGCCAGACTAAGA
CCTCTTCAGGCTGTTAAGCTAATGCGGGAGAAACTAAAAG
ATGGCAGCAGTGAACGCGGGGACAAAGATGCCAGTAAGAT
CACTACATATCCTCCTGGGGCCGTTCGTTTCGACTGTGAG
CTGCGAGCTGTGCAGGTCAGCTGTGGTTTCCACCACTCCG
TTGTTTTAATGGAGAATGGCGATGTTTACACTTTCGGTTA
TGGACAACATGGACAACTTGGACATGGAGATGTTAATTCT
AGGGGCTCCCCCACTTTGGTGCAAGCTTTGCCTGGCCCCA
GTACTCAGGTGACAGCAGGCAGTAACCACACTGCAGTGCT
TCTCATGGATGGACAGGTCTTCACCTTCGGGAGCTTCTCA
AAAGGACAATTAGGGCGGCCCATCCTAGACATGCCCTACT
GGAATGCCAAGCCCTCTCCAATGCCCAACATTGGTGCCAA
ATACGGTCGAAAGGCAACGTGGATTGGAGCCAGCGGCGAT
CAGACCTTCCTTCGAATCGACGAAGCGCTGATCAACTCTC
ACGTTCTGGCCACCTCTGAGATTTTTGCCAACAAACACAT
CATTGGTTTGGTTCCAACGTCTATATCTGAACCTCCTCCT
TTTAAATGCCTGCTGATCAACAAACTGGATGGGAGCTGCC
GCACATTCAATGACTCCGAGCAGGAGGATCTCCAGGGGTT
TGGCCTCTGCTTGGACCCTGTCTATGATGTCATTTGGAGG
TTTCTCCCTGTCACGCGGGAGATGTGCTGCTATAACGCTG
TGATAGCAGATGCTCGTGTGCCCACTGCCTCCGACATCCA
GGCCCTCTGCAGCATCCTGAGCCCTGAACTGGCTCTGCCC
TCAGGATCCCATGCCAGCACCACCCGCTCCCATGGAGCTC
TGCACATCCTGGGTTGTCTTGACACACTGGCTGCTATGCA
GGAGCTGAAGATGGGTGTTGCCAGCGCTGAGGAGGAGACC
CAGGCTGTTATGAAAGTCTACTCAAAAGAGGATTACAGTG
TCGTCAACCGCTTTGAGAGTCATGGAGGAGGCTGGGGTTA
CTCTGCCCATTCAGTAGAGGCCATCCGCTTCTGCGCTGAT
GCTGACATCTTGTTAGGGGGTTTGGGTCTTTTTGGTGGTC
GAGGAGAATACACTGCAAAGATCAAGCTGTTTGAGCTGGG
TCCAGATGGAGGAGACCATGAAACTGATGGAGACCTTCTG
GCAGAGACGGATGTTCTGGCATATGACTGTGCTGCTCGGG
AGAAGTACGCCATGATGTTCGATGAGCCTGTTCTGCTTCA
GTTGGGCTGGTGGTACGTGGCGTGGGCACGTGTGTCTGGA
CCGAGCAGTGACTGCGGTTCCCACGGCCAGGCCACAATCA
CCACGGATGATGGTGTGGTCTTTCAGTTCAAGAGCTCAAA
AAAATCAAACAATGGTACTGATGTGAATGCTGGACAAATA
CCTCAGCTGTTGTACAGGTTGCCTTCTAATGATGGAAACG
CTTCCAAAGGAAAGCAGCAGACCAGTGAACCTGTACACAT
CCTCAAGCGCACTTTTGCCAGGACCGTGTCTGTGGGTTTC
CAGTTCACAGCTACCCTTCTGGACCTCGAGCGCCTGCGGT
TTGTGGGCACCTGCTGCCTGCGACTGTTGCGAGTCTACAT
CTGCGACATCTTCCCCATTTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations