Transcript

mycbp2-201

ID
ZDB-TSCRIPT-090929-22165
Name
mycbp2-201
Previous Names
  • mycbp2-001
  • ottdart00000042443
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042443 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042443|OTTDARG00000030613|ZDB-GENE-030616-132 mycbp2|OTTDARP00000033746 mycbp2-001 LG_none CU138551.6,AL840634.16,CR628366.8,BX510646.5 Danio rerio protein_coding KNOWN, 15337 bp
GACAGTCAGCGACATGAACAGGGAAGGATGATGAAGCTAA
GATGGCAGCGCTACTAGGGGTGCTGTCTTTACGGGGTCAA
GAAAAACAGCAGGAATAAACGCAGAGCACGGACGTCAGCT
CGCGCATTTGAGTTATTTCACTTCGGCCAATTGAACGTGG
TTGGATCGCCTGCAATCGGGGAAATAACGGTTGATTCGGC
CGATCCGGCGCAGGAAGGGACGCGTATTTCGCAGTCGCAG
CAGAGCGGCTAACCGTAAACGTCGTTTCAATCGGGGATAC
TCGGATGTAATTCGCCGGGCGTTTTGCGGGTTTGCGGAGA
GGATTTATGGAGTGCGACTGGGACTTTTAGCTCTGTTGAT
TGACAGTGTAATCTAATATATGCGTTGTTCCCCTAAACGA
TGATGTGTGCTGCTGCGGCAGCGGGTGCCGGTGGAAGCGG
GATTCTGTCCTCCTCATCCCACTCCATGGGGCTGGGTGTC
AGGGTCATCCCCGGAGCTGGAAACGATTTCGCACCGATCG
GATCAGGGATGGGCTCCTGTCCCGTTGTAGGGGCCCGCTC
GGATTGTCGGAGCCGCTACCAGCTTCTTCTCTCAGGGCGA
GCACTGGCGGAGCGGTACCGGAGGATTTACACCACCGCGA
TCAACGACAAAGAGCAGGGGCTCAACCTCGGCAGGGGGAA
GAAAGCTTTGAGCAAGAAGAAGCTAAAAAGGAGGCAAAAA
GTCAAATCAAAAGTAAAAACAAGAACAAAGACAGATACTC
TGGATGGGGCCTTTCCAGTGCCTGACATCAAACTCCACAG
CAATCCCTCTGCATTCAATGTCTACTGTAATGTACGGCAC
TGCGTGCTGGATTGGCAGCAGAAAGAGGCCGCATTGGCCC
TCGCCTCTCGAAACTCTGTGCAGAGCGGTGACTCTGACAG
TGAGGAAGAGGAGGAGTACCGCGAACCTTTTGTCAAACTG
CCGAAGATCATTGGGATTGGACTGTGTGGAGTGTTTGAGC
TCATCAAAGAGACCCGTTTCTCGCACCCGTCACTGTGCTT
ACGGAGCCTTCAGGCCCTTCTAGATATGCTCCAGGGACAG
CAGCCAGAGAGCTTTCAGACCGAACCACCAGATGTGCTGG
AGTCTCTGTTCCACCTTCTGTTGGAGACAACGGTGCGGAG
CACAGGGATGAATGACCCCACTGGTCAGACTCTGACAGCG
TTATCCTGCGCCTGCCTCTTCAGCCTGGTGGTGGCTTGGG
GAGACACCGGCAAAACCCTACAGGCTGTGTCTGCTATCCT
CACCAACAATGGCAGTCATGCATGCCAGACCATCCAGGTT
CCAACAATCCTAAATGCACTACAGAGAAGTGTGCAGGCGG
TTCTGGTGGGGAAGATTCAGATCCAGGAATGGTTCGGAAA
TGGCATCAAGCGAGCTGCACTAATGAACAAATGGGTTCTG
AAGGAGGTGAACATCGATGACGACGAACACTGTCTTCTTC
AAACAGATGGTTCCTTTCTTTACCTGCTCTGTAAAGATGG
TCTCTACAAAGTAGGCTCAGGATACAGCGGCACCGTTCGG
GGCCATGTATACAACTCCACATCACGTATCAGGAACCGTA
AGGAGAAAAGGTCATGGCTGGGATTCGCCCAGGGTTGTTT
GCTATATCGAGACATGAACAGTCACAACATGGCAGCCATA
AAGATCAACCCAGAGACTCTGGAGCAGGAGGGCACTATCA
CAGTGCCTGGTCTGCAAGCAGATGGACAGAACATCATATT
CACTGACGGAGAATATATCAACCAGATTGCAGCCTGCAAA
GATGATGGCTTTGTGGTGCGGATCTATGCTACCAGCTCAG
ACCCAGCTTTACAGCAGGAGCTGCAGCTCAAACTGGCCAG
GAAGTGTCTTCATGCCTGTGGGATTTCCCTCTTCGACCTG
GAGAAAGATCTTCATATCATCAGCACAGGGTTTGATGAGG
AAGCAGCCTTGATTGGAGCTGGCAGAGAGTTTGCTTTGAT
GAAAACTGCATCTGGCAAGATCTACTATACTGGAAAGTAT
CAGAGCCTCGGTATCAAACAGGGCGGACCATCGTCTGGGA
AGTGGGTGGAGTTGCCTGTCACCAAATCACCCAAGATTGT
GCAGTTCTCAGTGGGACATGACGGCTCCCACGCCCTGCTG
GTGGCGGAGGATGGGAGCGTCTTCTTCACGGGCTCCGCCA
GCAAAGGGGAGGACGGAGAGTCAACAAAGAGCAGAAGACA
ACCAAAGCCCTACAAACCTAAGAAGATGATCAAACTCGAA
ACCAAGATGGCCGTTTACACAGCCTGCAACAACGGCAGTA
GCAGCATCGTCACTAAAGATGGAGAGCTCTACATGTTTGG
CAAGGATGCCATTTACAGTGACAGTACCTGCCAGGTATCA
GATTTGAAGGGACACTTTGTAACTCAGGTAGCCATGGGAA
AAGCTCACACCTGTGTCCTGACCAAGAGCGGGGAGGTTTG
GACCTTTGGAGTGAACAACAAAGGCCAGTGTGGTCGAGAC
ACTGGAGCTATGAGCCAGGCAGGGAAAGCGTTTGGAGTGG
AGAACATGGCCACCGCTATGGACGAGGACCTGGAGGACGA
GCTGGACGAGAAGGAGGAGAAGTCTATGATGTGTCAGCCT
GGCATGCACAAGTGGAAGCTGGACCAGTGTATGGTGTGCA
CTGTGTGTGGAGACTGCACTGGATATGGGGCCAGCTGTGT
GAGCAGTGGCCGACCTGACAGAGTGCCAGGAGGGATCTGT
GGCTGTGGCTCTGGCGAGTCGGGCTGTTCGTCATGTGGCT
GCTGTAAGGCTTGTGCCAGAGAGCTGGATGGTCAGGAAGC
CAGACAGAGGGGAATCTTTGATGCTGTGAAGGAAATGATA
CCGCTGGACCTGCTGTTAGGCGTCAATATAGAGGAGCACA
TCCAGATTCGACAGGAGGAGAAGAGACAGCGCATCAACCG
CCGCCACCGGCTGGAGGAGGGCCGAGGCCCCCTTGTTTTC
CCTGGTCCCCTTTTTATGAACCAGCGTGAGCAGGTGCTAG
CCAGACTAAGACCTCTTCAGGCTGTTAAGCTAATGCGGGA
GAAACTAAAAGATGGCAGCAGTGAACGCGGGGACAAAGAT
GCCAGTAAGATCACTACATATCCTCCCGGGGCCGTTCGTT
TCGACTGTGAGCTGCGAGCTGTGCAGGTCAGCTGTGGTTT
CCACCACTCCGTTGTTTTAATGGAGAATGGCGATGTTTAC
ACTTTCGGTTATGGACAACATGGACAACTTGGACATGGAG
ATGTTAATTCTAGGGGCTCTCCCACTTTGGTGCAAGCTTT
GCCTGGCCCCAGTACTCAGGTGACAGCAGGCAGTAACCAC
ACTGCAGTGCTTCTCATGGATGGACAGGTCTTCACCTTCG
GGAGCTTCTCAAAAGGACAATTAGGGCGGCCCATCCTAGA
CATGCCCTACTGGAATGCCAAGCCCTCTCCAATGCCCAAC
ATTGGTGCCAAATACGGTCGAAAGGCCACGTGGATTGGAG
CCAGCGGCGATCAGACCTTCCTTCGAATCGACGAAGCGCT
GATCAACTCTCACGTTCTGGCCACCTCTGAGATTTTTGCC
AACAAACACATCATTGGTTTGGTTCCAACGTCTATATCTG
AACCTCCTCCTTTTAAATGCCTGCTGATCAACAAACTGGA
TGGGAGCTGCCGCACATTCAATGACTCCGAGCAGGAGGAT
CTCCAGGGGTTTGGCCTCTGCTTGGATCCTGTCTATGATG
TCATTTGGAGGTTTCTCCCTGTCACGCGGGAGATGTGCTG
CTATAACGCTGTGATAGCAGATGCTCGTGTGCCCACTGCC
TCCGACATCCAGGCCCTCTGCAGCATCCTGAGCCCTGAAC
TGGCTCTGCCCTCAGGTTCCCATGCCAGCACCACCCGCTC
CCATGGAGCTCTGCACATCCTGGGTTGTCTTGACACACTG
GCTGCTATGCAGGAGCTGAAGATGGGTGTTGCCAGCGCTG
AGGAGGAGACCCAGGCTGTTATGAAAGTCTACTCAAAAGA
GGATTACAGTGTCGTCAACCGCTTTGAGAGTCATGGAGGA
GGCTGGGGTTACTCTGCCCATTCAGTGGAGGCCATCCGCT
TCTGCGCTGATGCTGACATCTTGTTAGGGGGTTTGGGTCT
TTTTGGTGGTCGAGGAGAATACACTGCAAAGATCAAGCTG
TTTGAGCTGGGTCCAGATGGAGGAGACCATGAAACTGATG
GAGACCTTCTGGCAGAGACGGATGTTCTGGCATATGACTG
TGCTGCTCGGGAGAAGTACGCCATGATGTTCGATGAGCCT
GTGCTGCTTCAGTTGGGCTGGTGGTACGTGGCGTGGGCAC
GTGTGTCTGGACCGAGCAGTGACTGCGGTTCCCACGGCCA
GGCCACAATCACCACGGATGATGGTGTGGTCTTTCAGTTC
AAGAGCTCAAAAAAATCAAACAATGGTACTGATGTGAATG
CTGGACAAATACCTCAGCTGTTGTACAGGTTGCCTTCTAA
TGATGGAAACGCTTCCAAAGGAAAGCAGCAGACCAGTGAA
CCTGTACACATCCTCAAGCGCACTTTTGCCAGGACCGTGT
CTGTGGACTGTTTCGAGTCTCTGCTGAGTATCCTGCACTG
GAGCTGGACCACGCTAGTGTTGGGAGTGGAGGAGTTGAGG
GGATTGAAGGGTTTCCAGTTCACAGCTACCCTTCTGGACC
TCGAGCGCCTGCGGTTTGTGGGCACCTGCTGCCTGCGACT
GTTGCGAGTCTACATCTGTGACATCTTCCCCATTTCTGCC
AGCACCAAAGCGATTGTGGAGGAGTCCAGCAAGCTGGCGG
AGTGTGTGGGAAAAACACGTAGCCTACTGAAGAAGATCCT
GTCAGAAGGAATGGACAACTGCTTGACCAAGCTGGACAAC
GACCCACAGGGATATCTGAGTCAACCGCTCACGCTGCTGG
AGGCTGTGCTGCAAGAGTGTCATAACACTTTCACAGCCTG
CTTTCACTCCTTCTACCCGACTCCGGCTCTGCAGTGGGCC
TGTCTCTGCGACCTACTCAACTGCCTGGACCAGGACATTC
AAGAGGCAAACTTCCGCACATCGAGCAGTCGTCTGCTGGC
TGCGGTGATGTCAGCGCTGTGCAACACATCGGTCAAGCTG
ACCTCCATCTTGCCCATTGCGTATGATGGGGAGGTGTTAC
TCCGCTCTCTCGTCAAGCAGGTCAGCACAGAGAATGACTC
TGCCCTTGCTCACCGCTTCCCCCTGCTGGTGGCACACATG
GAGAAACTCAGCCACACGGAAGAGAATCTCATGGGCATGA
CAACATTCCGGGAGGTTCTGGAGAAGATGCTAGTCATTGT
AGTGCTTCCTGTGAGGAAGAGTCTTAGAAAAGAGGTCGAG
CTCTTTTCTCCTCATCTCGTGTCCAACACCTGTGGTCTGC
TGGCCAGTATTGTCAGCGAGCTCACCGCATCTGCTCTCGG
TTCTGAGGTGGATGGTTTGAACTCCCTGCACTCTGTGAAA
GCCACCCCCAACCGCTTCACCAAAACCAGCCAGGGACGCA
GCTGGAACACTGGGAATGGCTCCCCCGATGCCATCTGCTT
CACCGTGGACAAGCCAGGGGTGGTGCTGGTGGGTTTCTGT
GTGTACGGCGGAGGAGGCATTCATGAGTATGAGCTGGAGG
TGCTCGCTGATGATGCTCAGACGGAGCACCCTGGAGATTC
CGCCCACTCCCACAGATGGACATCTCTAGAACTGGTCAAA
GGCACTTACTGCACTGATGACTCCCCCAGTGACATCGCCG
AGATCCGTCTGGACAAAGCTGTTCCTCTGAAGGAAAATGT
GAAATACGCCGTTCGTCTGCGTAACTATGGCAGCCGCACA
GCCAATGGGGACGGAGGCATTACCACCGTGCAATGCTCTG
ATGGAGTCGCCTTTACCTTCAGCACCTGCAGCTTGAGCAG
CAATGGCACCAATCAGACCAGAGGCCAGATCCCTCAGATT
CTTTATTACAGGAGTGAATATGATGGTGATCTTCAGTCAC
AGCTGCTAAGCAAAGCCAATGAAGAGGACAAGAATTGCAG
TCGAGCCCTCTCTGTAGTCAGCGTAGTTGTACGGGCAGCC
AAAGACCTCCTTCATAGGGCCTTTGCTGTGGATGTTGAAG
ATATTCCAGAGCTGTTGAGTTCCTCCAGTCTTTTTTCAAT
GCTGCTTCCACTTATTTTGGCATATATTGGTCCTGTGGCT
GCCTCTGTTCCTAAGGCTGCGGTGGAGGTGTTTGGTTTGG
TTCAGGAACTTCTTCCAGCTGTTTCTGCCCTGAACCAGAA
ATATGCCCCGCCCACCTTCAACCCTAACCAATCCACTGAC
AGCACTACTGGGAACCAGCCAGAGCAGGGCCTGTCAGCTT
GTACCACATCCAATCATTATGCTGTTCTAGAGAGCGATCA
CCCCTACAAGCAGGCTGGTGTCACTCAATACAAGGTTTCA
TTCCCAGACTGTGTTCGCTGGATGACAGTTGAGTTTGATC
CTCAGTGTGGTACAGCTCAGCCAGAAGATGTCCTCCGTCT
CCTGATCCCCAGCCGATCGCTGCACTTCTCCGGGCTCAGC
TCCAAAGCTCTGGCTCACGAGACCATCAACAGCTGGACTG
AGCTCAAGAAGTTCTCTGGCTCAAGTGGCTGGCCCACGGC
TGTCTTAGTGCTGCCAGGTAACGAAGCCCTTTTCTCCTTG
GAAACTGCATCGGATTATGTGAAGGATGAGAAAGCCTCTT
TCTACGGATTCAAATGTGTAGCTGTCGGTTACGAGTTTAA
CCCTGGACTTGATGAGGGAATTATTCAGTTGGAGAAGGAA
TTGGCCTATTTAGGAAGCGTGTGTGCGGCTGCTCTCATGA
AAAAGGATCTTGCCCTACCCATAGGAAATGAACTGGAGGA
GGATTTGGAGATTTTAGAGGAGGCCTCACTCCAGGTTTGT
AAATCCCACTCCGGGCTCCTGGGGAAGGGACTGGCTCTGT
CTCATTCTCCCACCATCCTAGAAGCACTGGAAGGGAACTT
GCCATTGCACCTGCAGACCAACGAACACTCCTTCCTAGAG
GACTTCATCACCTGCGTGCAGAGCTCCAGTGGCGGGCGAC
TCGCCAGGTGGCTTCAGCCAGACTCCTACGCAGACCCTCA
GAAGACATCACTGATCCTAAACAAAGATGACATCCGCTGT
GGCTGGCCCACTACTGTTGTGGTCCAGACCAAAGATCAGT
ATGGAGATGTTGTGCATGTGCCGAACATGAAGGTTGAAGT
CAAAGCTGTTCCCGTCTCTCAGAAGAAGTCCATCCAGCAG
GAGAACATGAAGAAATTGCAGCGTTTGCCAGGCACTTCCT
CTAATTCTGCAACAGGCACTGATCTCACATTTGGTGGTCA
TCCAGCACCCAAACTGGAGGCGACATACGAGCCCATGATC
ATCAAAGAGGCCCGTTATATCGCCATCACTATGATGAAGG
CATATGAAAATTACTCCTTTGAGGAACTTCGCTTTGCTTC
ACCAACACCAAAAAGGCCCAGTGAGAACATGCTTATCCGG
GCCAACACAGATGGCACTTACAGCGCTAACTGGACCCCTG
GTGCTGTTGGACTATATACCATTCATGTTACCATCGATGG
CATCGAGATCGATGCTGGTCTGGAGGTCGAGGTCAAAGAC
CCACCCAAAGGAATGATCCCTCCTGGCACACAGATGGTCA
AACCTAAAGCTGAACCTCAACCTAGCAAGGTGCGCAAATT
TGTGGCCAAGGACAGCGCAGGGCTGCGTGTGCGTAGTCAC
CCTTCTCTGCAGAGCGAACAGATAGGCATAGTCCAAGTCA
ATGGCACCATCACATTCATTGACGAGATCCACAATGATGA
TGGTGTCTGGCTCAGACTGAATGATGAGACAGTAAAGAAG
TATGTTCCCAACATGAATGGCTACACTGAAGCCTGGTGCC
TCTCTTTTAACCAGCATCTGGGCAGAAGCCTCCTGGTCCC
TGTCGACGTGATAAACTCGGAGGGCACCTGGGTGCAGCTG
GATAAGAACAGTGTGGTGGAGTTCTGTGAAAGTGATGAAG
GCGAGGCCTGGTCTCTGGCCAGAGACAGAGGGGGGAACCA
ATACCTGCGGCACGTTGAAGAGCAAGCTGTTTTGGAGCAC
GGAGCACAGACGCCTCCTCCCAGCCCATTCTCTGTTCAGG
CGTTTAACAGAGGCATGGCCAGCTCAGGAGCTCAAGGCTT
TGACTACGGCATCTCCAACAACAAAGGTGACAGAGATAAC
ATGGCCAGTTGGTCTGTGTCTCCAGGCAGCAAACATCGTC
AAGAGAGCCGATCCTCCAAAACCGACAGCCACTCAAACCG
ATCTGTTGACCAGGTGAAGAGCAAGAACAACGAGAGTCTG
TCTGCCAGCGAAGCCCTCATTCTGAAATCAGATACAGGCA
AATTGCGGTCTGACTCTCACAGCCGCTCCCATTCTCCTAA
CCACAACACTCTTCAAGCCCTGAAAGCTGATGGCAGAACC
TCAGGACTTAGGGCTGAGTCTCCAAACCCTGGCTCCCGAT
CCTCCTCACCAAAACAAAAGACCTTCACTTCAGGGAGATC
TAGCCCTTCTAGCACCAGTTCCCCACGCTCATCATCTCCT
CATGATAAGAACCTGCCCGCCAAAGTTAGTCCCTCTAAAG
TTCACCTGGATCCACCACGCGAGAGATCCAAATCGGACTC
TTATACACTAGATCCTGACACTCTTAGAAAGAAGAAGGTC
CCTCTTATGGAACCTCTAAGGGGCAGGTCTACATCCCCAA
AGCCAAAACTCCCACCCAAAGAGAGCAAAGGAGGTAGCAG
CAATGCAGAAAACCGAGCCCCTTCTCCCCATGTAGTTCAG
GAAAATCTCCACAGTGAAGTAGTGGAGGTATGTCGGTCTA
GCGCCTTGCTATCCAACGATGAAGGCAATGATGAGAATTC
AGAGTTGCACAATGCTGAAGAAGGCTCCTCCAAGGTCCAT
TTTAGCATTGGAAAAGCACCAGTCAAGGAAGAACTTGAAA
GTCGCTCTTCACCCAAAGTCAGCCGTAAAACCTCTAGCAG
GCATGTAAGACCCAAAAAAGACAAATCAGGGCCACTCTTT
AAGGGGGAAAATGTGCGTCCCACTGAACCTGCCAAGCAAG
CCATGTCACCTTCTGTCGCTGAATGTGCCCGTGCTGTTTT
TGCTGCCTTTCTGTGGCATGAGGGTATTGTACATGATGCC
ATGGCATGCTCTTCTTTCCTCAAGTTCAACCCTGAGCTGA
CCAAAGAACATGCACCTATCCGTAATTCCCTCAGCTGCCA
ACAAGGTTTTGATGAAAAAGAGAGCAAACTGAAGAACCGG
CACTCTCTGGAGATCTCCTCAGCCCTCAACATGTTTAACA
TATCACCACATGGCCCAGACATTTCCAAGATGGGTAGCAT
AAACAAGAACAAGGTCCTTTCCATGCTAAAAGAGCCACCC
TTGCCTGAGAAGTGTGAGGATGGAAAGGAATCTGTCTCTT
ATGAGATGACCAGTCACTCCTCCATGAGGTCAAAATCCAT
TTTGCCTCTTACTCTCCAGCACTTAGTAGCCTTCTGGGAG
GACATATCAATGGCTACCATAAAAGCGGCAACACAGAACA
TGATCTTCCCAAGTCCAGGATCCAGTGCTATCCTTAAAAA
GAAGGAGAATGAAAAGGACAGCAAAAAGACAAAGAAAGAG
AAGAAGAAAAAGGAGAAAGCTGAGGTACGCCCTAGGGGAA
ACCTCTTTGGGGAGATGGCGCAGTTAGCTATGGGAGGTCC
AGAAAAGGATACCATCTGTGAGCTCTGTGGAGAGTCTCAT
CCATACCCTGTTACATACCACATGCGGCAGGCCCACCCAG
GATGTGGTCGGTATGCTGGAGGTCAAGGCTATAACAGTAT
TGGTCACTTCTGTGGAGGCTGGGCTGGAAACTGTGGTGAT
GGTGGGATTGGTGGAAGCACCTGGTACTTGGTGTGTGATC
GTTGCCGAGAGAAGTATCTGAGAGAAAAACAAACAGCTGC
TAGAGAAAAGGTTAAGCAGTCGAGGAAGAAACCTCTCCAG
GTGAAAACGCCACGAGCTCTGCCTACAATGGAGGCCCACC
AAGTGATCCGTGCGAATGCACTTTTCCTTCTTTCTCTAAG
CAGTGCTGCTGAACCTAGCCTGCTTTGCCATCACCCACCC
AAACCTTTCCACAGTCATCTGCCAAGCCTCAAGGAGGGAG
TGTCTGAGGAACTACCCAACAAGATGGGCTGCCTCTATTT
GCAAACCCTAGCCCGCCAACACACAGAGAACTTTGGAGTC
TATCAAGATGACAACCTTTTTCAGGATGAGATGCGTTACC
TGCGGTCTACTTCTGTTCCTGCTCCTTATATCTCAGTCAC
TCCAGATGCCTGCCCCAATGTTTTTGAAGAGCCAGGAAGT
AACATGAAGTCCATGCCACCAAGTTTGGAGACAAGTCCAA
TCACAGACAGTGACACAGCCAAGCGAACAGTATTCCAGCG
CTCATATTCAGTAGTGGCCTCTGAGTATGATAAGCAACAC
TCAGCCTCTCCAGCAAGGGTTAAAGCAGTGCCAAGACGAA
GAGTTCACAGTGGAGATGCAGAAGTTGGGTCATCGTTGCT
TCGTCATCCTTCTCCTGAGTTGTCTCGACTGATCTCAGCC
CATGGCTCTCTCAGCAAGGGTGAACGGAACTTTCAGTGGC
CTGTGTTGGCATTTGTCATCCAGCATCATGACCTAGAGGG
CCTGGAGGTGGCTATGAAGCATGCACTCCGCAAATCAGCC
TGCAGGGTGTTCGCCATGGAGGCGTTTAATTGGCTGCTGT
GTAACGTTACGCAAACCACCTCCCTCCATGATATCCTGTG
GCACTTTGTGGCATCTCTGACTCCTTCTCCTTTTGAGACT
GAAGAAGAGGAGGATGAAGAGAACAAAGGGAACAAGGAGA
ACCTTGAACAGGAGAAAGATTTAGGTGTCTGTGAGCACCC
CCTGTCTGACATTATCATCGCCGGAGAAGCAGCTCACCCG
CTCCCTCACACTTTCCACTGTCTTCTCCAGACCATCTCTG
ACCTTATGATGTCACTTCCCAGTGGAAGCTCACTTCAGCA
GATGGCCCTGAGATGTTGGAGCCTTAAATTTAAACAGTCG
GATCATCAGTTCCTGCACCAGAGTAACGTATTTCACCACA
TCAACAACATCCTTTCTAAATCAGATGATGGGGACAGCGA
GGAGAGTTTTAACATCAGCGTACAGTCAGGATATGAAGCC
ATTAGTCAGGAACTTTGTGTGGTGACCTGTCTGAAAGATC
TGACTAGCGTGGTGGACATTAAAACATCCAGTCGGCCAGC
CATGATTGGCAGCCTGACTGATGGCTCCACTGAGACATTC
TGGGAGTCTGGGGATGAAGATAAGAACAAAACGAAGAGTA
TCACTATCAGCTGTGTGAAAGGCATCAATGCGTCATATGT
CTCTGTCCATGTTGACAACTCTCGTGATATTGGAAACAAA
GTCACATCAATGATATTTCTGTGTGGGAAGGCTGTGGAAG
ATCTCTGCAGAATAAAACAGATTGACTTGGACTCGAGGCA
CATGGGCTGGGTGACTAGCGAGCTGCCCGGAGGGGACCAT
CACGTGATCAAGATTGAGCTTAAGGGTCCTGAGAACACGC
TTAGGGTACGGCAGGTCAAAGTACTTGGCTGGAAAGAGGG
AGAGAGCATCAAGATCGCTGGGCAGATATCAGCCAGTGTG
GCCCAGCAGAAGAATTGTGAGGCTGAGACGCTGCGTGTCT
TCCGACTCATCACATCACAGGTATTTGGGAAACTAATATG
TGGGGATGCAGAACCAACACCAGAACAAGAAGAAAAGAAC
CTGCTCTCCTCACCTGAGGGTGAAGACAAGGCTCCATCTG
ATGCAGACTTAAAGGAACACATGGTTGGCATTATTTTCAG
CAGGAGCAAACTGACCAACCTTCAGAAACAGGTGTGTGCC
CATATTGTCCAAGCCATTCGTATGGAGGCCACACGAGTGC
GGGAAGAATGGGAACATGCCATCTCCAGCAAAGAGAATGC
AAACTCTCAGCCCAGCGACGATGACGCGTCTTCTGATGCT
TACTGCTTTGAGTTGTTGTCTATGGTGCTGGCCTTGAGTG
GATCTAATGTTGGTCGCCAGTATTTAGCCCAGCAGCTCAC
GCTGCTGCAGGACCTCTTTTCCCTTCTTCACACCGCCTCG
CCACGTGTCCAGAGACAGGTGACGTCACTGCTCAGGCGTG
TTCTTCCTGAGGTCACACCCATGCGCTTGGCCAGTGTTAT
CGGTGTAAAGGCGCTGCCACCGGCTGACATCAGTGACATC
ATTCACTCTACTGAGAAGGGAGACTGGACCAAGCTCGGTA
TTTTAGATATGTTCCTGGGCTGCATCGCCAAGGCCCTCAC
TGTGCAGCTCAAGGCCAAGGGCACCACTATTGTTGGCACA
GCTGGCATGGCTGCGGGCAAAGGGGTCACTACAGTCACCT
TGCCCATGATCTTCAACTCAAGTTATATACGACGCGGAGA
AAGTCATTGGTGGATGAAGGGCTCTACTCCACCTCAGATT
GCTGAAATTATCATTAAACTAGTCAAAGACATGGCTGCTG
GACACCTCTCAGATGCCTGGTCCAGGGTGACTAAGAATGC
CATTGCAGAGACCATCATTGCACTCACAAAGATGGAAGAG
GAACATCGCTCTCCAGTTCGCTGCATTGCCACTACACGGC
TGTGGCTTGCATTGGCCTCTCTGTGTGTTCTGGATCAGGA
CCACGTGGACCGACTGTCTTCTGGTCGCTGGATGGGCAAA
GATGGGCAGCAGAAGCAGATGCCTATGTGTGATAACCATG
ACGACGGCGAGACGGCAGCCATCATTCTGTGTAATGCATG
TGGAAATCTGTGCACTGATTGTGACCGCTTCCTCCATCTC
CACCGGCGCACACGTACCCATCAGAGACAGGTTTTCAAAG
AGGAGGAGGAGGCCATTAAAGTGGACCTACATGAAGGCTG
TGGTAGAACCAAACTCTTTTGGCTCATGGCATTGGCAGAT
TCCAAGACCATGAAGGCCATGGTGGAGTTCCGTGAACACA
CAGGTAAACCAGCTTCCAGCAGTTCAGACGCCTGCCGCTT
CTGTGGCACTAGGCACGGCACAGAACTGTCTGCAGTGGGA
AGTGTATGTTCAGACCAAGACTGTCAGGAGTACGCAAAAC
TGGCCTGCAGTAAGACTCATCCATGTGGTCACCCATGTGG
AGGGGTCAAAAATGAGGATCTGTGTCTTCCCTGTCTGCAT
GGTTGTGACAAAACCGCAACCTGTTTGAAACAGGACGCTG
ATGATATGTGCATGATTTGCTTCACTGAGGCTCTGTCTGC
TGCCCCAGCAATCCAGCTGGACTGCAGTCACGTTTTTCAT
CTTCAGTGCACAAGAAGAGTTCTGGAGAACCGCTGGCTTG
GACCCAGGATAACCTTCGGGTTTATGTCTTGCCCTATTTG
TAAGAACAAAATAAACCATTTGGTTTTAAAAGACTTGCTG
GACCCCATCAAAGAGCTGTACGAAGATGTGAGGAGAAAGG
CTTTAATGAGACTGGAGTATGAAGGCCTACACAAGAGTGA
AGCCATCACAATGTCTGGAGCTCGATTCTTCAACAACCCT
GCAGGATTTGCCATGAATAGATATGCATACTACGTCTGCT
TCAAATGCAAAAAGGCCTATTTCGGGGGAGAAGCTCGCTG
TGATGCCGAGGCAGGACAAGGCGATGATTATGATCCCCGT
GAACTCATCTGTGGAGCCTGTTCTGATGTGTCTAGGGCAC
AGATGTGCTCCAAACACGGGACTGATTTCCTGGAGTATAA
ATGCCGTTACTGTTGCTCCGTGGCTGTGTTCTTCTGCTTC
GGGACAACGCATTTTTGCAACGCTTGTCATGATGACTTCC
AGAGGATGACCAGTGTCCCAAAAGAAGAGCTGCCTCATTG
TCCTGCTGGACCAAAAGGAAAACAGTTAGAGGGAAGCGAG
TGTCCCCTGCACGTGGTACATCCTCCCACTGGAGAAGAGT
TTGCGCTGGGGTGTGGTGTGTGTAGAAATGCACATACCTT
CTAAACAAACAACAACACTGGGGTCCTGTGTTGATCTCTC
TAAGTATATATATATATATTCACCCCTCTGTGGCGGCTGA
TTTCCTCTTCAGCTCAGTCTGAGAGCAGATATACTGGACG
CTCCATCCCAAGGGGGCTGTGACCAATCACCTTGCTCCAG
GGTGCATCCTCCCTCTCTTTAGATGCTGAAGAATTAAAAA
AAGAACAAAAACATTTATTTAAAAAAAAAAAAAAACGTGA
CGTGTTTGCATGCAGCCGTTGTAACCCTAGCGGCTTGTAT
AAACGTTGCACACCTCCCGACCACTGAAGTGTAACAATGT
ATGGAGGACTTTTGGAACTGAATTCAAGAGCACCGTGGAT
GGGCCGTGATTTCAGCTTCTCGAATACAAATTAAAGATTC
TATTGTTGTATGTAAACTGAATTTGTTTTGGTAATCTTGT
ACAGTATACCTTCACTTTGGAGTGCAACATGGTTTGACGG
CTAAAGATTCAAAACAAAAAAACATGCTATAAGAGGACTT
TAGAATGTCATGCTGGAGGAAAATAGTGTACGATTTATCT
AATCTTGTATATAATGTCAGTAACCCCTTCATATGTGTAT
TCCGATGTTGCTACTCTACACTTCAGTTTGGTTTGATAAT
TCTGGGTTATGTTTTGAGCCAGAACTTTTAATGAAGTGCA
ATACTGGGTGTGCCTCCTCGCAGATGTAAACATATGGAAT
GTATGTCAATAAAAGCCACTGTACATTTTTATACAGTGAT
AAACACGCTGTCGTGTTTCACCCATTCCCCTCCCCGGCAA
GTATGATATCATTTCTGTAGTCAGAACGTTATCGAGGGGC
TTATTGTCTGCGGTGTCTGCCCTTTTTGTCTCAATGATGT
GGTATAAACCCCTTTTTTCCTGTCATGAAAAAAAAAATAT
CTAAAGGTGAGTATGTTCTGCTTTTGTATTGTAAGAACAG
CACTCTTTGGGGCCAGTCTTCACACCAAATCAAAGCAACG
TGAGGCAACATAAGAGATATATTAGAAAATTGTGGCTATT
TAGTGGTTGTTTTGGAGGCATATGGGAGGATATTTTGGAG
GTGTGATAAACAGCTGCTGTAGAAAAAAAAGTAAAAGAAA
ATTGCAACTTGTGAATCTGCTTTGTATTATTATCTGTGGA
TGGAGCTGAATGGTAATAATAAACCGGGTTCTCTGTTCAG
CAAGGTACATTACCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations