Transcript

crebbpa-201

ID
ZDB-TSCRIPT-090929-2190
Name
crebbpa-201
Previous Names
  • crebbpa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012324 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012324|OTTDARG00000010667|ZDB-GENE-050208-439 crebbpa|OTTDARP00000047637 DKEY-44G23.1-001 LG_none BX908757.11,AL953841.5 Danio rerio protein_coding NOVEL, 8544 bp
CCGTATTTCGCTCCGAGCTGTTATTGTTTACCGGACGCTT
TTGGAGGACAGGCAGCGCCGAGGAGACTATTTTGCAAAAA
TATCTCATTTTTATGCAACCGTGCATTTTCACAAGAAGCC
AGAGGATTTTTGCACGGAAAAAATTGACGTCAGAAAATGG
ATCGCGTGCCGTTGCAAAATTAACGACGCTCGCGCGCGCA
GACTCCTATGGTTATTTTATTTGGGATTTTGCGTTGAATT
CGCGGAAAGGAGGCGTTTTCTCTCGGTAATATAACGATGA
TAATGTGGGTGTTGGGTGTTGGATTATCATGGGGTGAATG
GTGGTGGCGACGCGGGGCGCTGTTGCTGCTTTTTTGAGAA
AATCCTTCGCCAAGCCGCTCCACACTCCCCAAGTCTTTCA
AAAGTAAGGTAATATCTGTTTTTCCGACGAAAGGATCCTT
CACTTTGCATTTTTGACCCACAACACTCAGCCAGAAGCTC
ACTTGAATCGCAATGGCTGAAAATGTGCTCGACGTCGGCC
CTCCCAATGCGAAGCGGGCGAAGCTGACAGCACCTGCTCC
AGACGCACCAGAGTTGGGTTCACTTTCATGGGATGACCTG
GAGAACGATCTTCCAGATGAGCTGATTCCTAACGGAGACC
TGGGGCTGATGTCCTTGCCCTCAAACGGCGGGGCTGCAGG
TACGGGCGCTCACGGCCCCATGGTCCCCGACGCCGCTGCC
AAGCACAAGCAACTCTCGGAACTCCTGCGGCCGGGAAGCA
GCGCTGGCATGAACTCTGTCAGCCCACAGCCTGGCGGCAT
CGGACCTCAGCTTGGTGGGCTCGGAAAGAGTCCCCTAGGC
CAAGGCTCCCCTTCCCACCCTTCCCAAACACAAAAACCAG
GGGGCACTCCTGGGACGCAGGGCAATAACGCCGGATCAGC
TGGCATGGGATTTAACCAGGGTATGCTGAACAGCGGCATG
ATGGGACAGAATGCTGGTGCTCAAGGAGGTCAGGTGATCA
ATGGAGCTCTTGGGACTGTAGGCCGCGGTCGAGGCGTGCA
GGGAATGTACCAGGGTGCTGCCATGCAGGTTGCATCTTCT
GTTGGAGCGGGAGGAGGAGTGGGGGCGGCGGCACCTGGAG
GAGCAGGAAGTGTCCTAGCGGAAACGCTCACACAAGGGGC
ACAGCAGATGGGCATCAACGCTCAGCAGGCCAAGATGGGC
ATGGCAGGTGGCAACAGTCCATTTGGGCAGTACCAGGCTG
GAGGTCAACAACTGGGCACGAACGCACAGAATAAAGGCGC
CCTTCCCAACAGCCTCCCCCCATTTCCAACTGACCTAAAG
GGGGCGACTGTCACCAGCGTGCCAAACATGCCCCAGCAGC
AGCAGGTGTCGGTGGGCATGGTGGCGGGTCAGGGCGTATC
GACGGGTCCCACGGCTGACCCGGAGAAGCGTAAACTGATC
CAGCAGCAGCTGGTTCTGCTGCTTCATGCCCACAAGTGCC
AGCGGCGCGAGCAGGCCAACGGAGATGTGCGAGCATGTGC
TCTGCCACACTGCAGGACCATGAAGAACGTCCTCAACCAC
ATGACGCACTGCCAGGCTGGCAAGTCCTGCCAAGTGGCTC
ACTGTGCTTCATCGAGGCAGATCATCTCGCACTGGAAGAA
CTGCACCAGACATGACTGTCCTGTCTGCCTGCCCCTGAAG
AACGCCAGCGAAAACGCTAATAAACACAACCAGCAACCAA
TGCTGAGTCCCCCAAACGCTAGTCTACAAACCCCCATTGG
GTCTGTCGGCACGGGGCAGCAGACTGCGCCCGCTCTGCCC
AGCTCCACACCCATCGACCCAAGCTCCATGCGGCGGGCGT
ATGCTGCCCTCGGCCTCCCCTACAGCAATCAGAACCCCAC
ACAGACCCAGTCCCCCACGCAGACACAGGGCCCCGGACAG
ACAACGGCACAGACACCACACCAGCAGCCAATGAGATCCA
TCAATGCACTTGGAGGAGGTCAGTTGAACCCAATCGGCGT
ACCGACATCCGAACAGGCTAAGCTGCTCCCAGATGGCACC
ATGCCATCAACCCTTAACAATCCGGTGATGCCAGACGGCT
CTACAGTAGGCAATCTGAGTAACCTGCCCACTGCGGCCCC
TCTGTCAGCCACCGGTGTGAGGAAAGCCTGGCATGAGCAC
GTCACTCAGGACCTCCGCAATCACCTTGTACACAAACTGG
TTCAGGCCATCTTCCCCACACCAGACCCTGCTGCCCTGAA
GGACCGACGAATGGAGAACTTGGTGGCGTACGCACGAAAA
GTGGAAGGGGACATGTACGAGTCCGCCAACAGCAGGGACG
AGTACTATCACTTTCTGGCAGAGAAGATCTATAAGATCCA
GAAAGAGCTGGAAGAGAAGAGAAGATGGACCCGTGCCTAT
GCCCAATGTGCCAAATCAGATCCTGAATCGCATGCAGGGA
TGAATCCATTTAGTGCAATGTCCAATGTGCCGATGTCTCA
GGCTCCCATGGGAACACGTGCCGCCTCTCCGATCAACCAT
CAACAGATCAACATGAACCAAGTCCCAACAATGAACATGT
CTCCAACACGAATTGCTCCAACGCAAGGGATGCTAGGAGC
TCACGGAGGGAACATGGTCACGCAAACGCCCAACCAGACG
CAGTTCATGACTCAACCACCGTTTCCTGCTACCACCAACA
CCATGAACGTCAACATGGGCCAGCCCAACTCGCAGACACC
AGTTTCGCAGCAGCAGCCGAACGCTAACCTCCCCCTGAAT
GCACTTGGCCCCTTGGGCCCTGCGCTAGGCTGCCCCACGC
CCCCTCAGGCTCCACTGCGCGCCACACCGCCCCCCAACGC
CACCGCCGCCAGCACCACTAACCTGCCAGCAGCACTGCAG
CCCTCCACACCCACCCCCGCCCCTGCCCAGGCCACCCCGC
CGCACATGCAGACCCAGGCTGAGCTGCCCATCCCTGGCCA
GCAGCACCCTGGAACACCGACTGGTGAAAACCGTGTACCC
ACGCCAGCGTCAGCAGCCAGCACTGAGCTGCACTCCCAGC
ATGCTGTGCCTGACGTACCACCCAATGACACTAAAACAGA
AGAGCAGGATTACGACATGGCCGTCAAAACAGAGCCCAGC
ACGGAGACAGAGGAAGACACAGGCTCACTGCTAGTCAAAA
AGGAGGAGCAGGAGGGCTCGGAGGCCAAGCAGGAGCCAAT
GGAGACAGAGGACAAGAAGACTGACTTAAAGACGGAGACC
AAAGAGGAGGATGAAAGCAAGACAAACGGCACAGCGTCCT
CTTCACCGTCACAGTCTCGCAGGAAAATCTTTAAGCCAGA
AGAGTTGCGACAGGCTTTGATGCCCACCTTGGAGTCTCTG
TACAGGCAGGATCCAGAGTCTCTGCCTTTCCGGCAGCCTG
TGGACCCCATACTTCTAGGCATCCCTGATTATTTTGATAT
CGTGAAGAACCCCATAGACCTGTCCACTATCAAGCGTAAG
CTGGACACGGGTCAGTACCAGGAGCCCTGGCAGTACGTGG
ATGATGTGTGGCTGATGTTCAACAACGCCTGGCTATACAA
CAGGAAGACGTCACGCGTCTACAAGTACTGCTCCAAATTG
GCGGAGGTGTTTGAACAGGAGATTGACCCCGTCATGCAGG
GACTCGGGTACTGCTGCGGGCGGAAGTACGAGTTTTCTCC
TCAGACGCTGTGCTGTTACGGCAAGCAGCTCTGCACAATA
CCCCGAGACGGCACTTACTACAGTTATCAGAACAGATATC
ATTTCTGTGAGAAATGCTTCAATGAGATCCAGGGAGACAG
CGTGACGCTAGGAGATGATCCTGCTCAGCCTCAGACCATG
ATCTCTAAAGACCAGTTTGAAAGAAAGAAGAACGACACAT
TAGATCCTGAGCCGTTTGTTGAATGTAAAGATTGCGGGCG
GAAGATGCATCAGATTTGTGTCCTGCATTATGAAGTCATT
TGGCCTTCAGGTTTCATCTGCGATAACTGTTTGAAAAAGA
GTGCAAAGTCAAGAAAGGAAAACAAGTTTACGGCAAAGAG
GTTGCAGTCAACGAGGTTAGGCACTTACATAGAGGATCGA
GTGAACAAGTACTTGAAGAGGCAGAACCATCCGGAAGCTG
GAGAGGTGTTTGTACGAGTAGTAGCCAGTTCAGACAAAAC
GGTGGAGGTCAAACCTGGCATGAAGGCCAAGTTTGTGGAC
ACAGGAGAGATGATGGAGGCCTTCCCCTACAGAACCAAAG
CACTTTTCGCCTTTGAGGAAATTGATGGAGTGGATGTGTG
TTTTTTTGGCATGCACGTGCAAGAATACGGCTCTGATTGC
CCTTTCCCTAACACCAGACGGGTATACATATCATACCTCG
ATAGTATTCACTTCTTCAAACCTCGCATGCTGAGAACAGC
TGTCTATCACGAAATCCTCATTGGCTATTTAGAATACGTC
AAGAAGCTTGGATATGTTACGGCACACATCTGGGCATGTC
CGCCTAGTGAGGGTGATGACTATATCTTCCATTGTCACCC
TGCCGACCAGAAAATCCCAAAACCTAAGCGCCTGCAGGAG
TGGTACCGCAAAATGTTGGACAAAGCCTTTGCTGAGCGGA
TTCTGCATGACTACAAGGACATTTTCAAACAAGCCACAGA
GGACCGTTTGACGAGTGCAAACGAGCTTCCATATTTTGAG
GGGGATTTTTGGCCCAATGTATTGGAAGAGAGCATCAAGG
AGTTAGAGCAAGAGGAAGAAGAAAGGAAAAAAGAAGAAAA
CACGGCAGCTTGTGAAACTCCGGAGGGCACACCAGGAGAC
AGTAAAAATGCAAAGAAGAAGAACAACAAGAAAACGAATA
AGAATAAAAGCAGCTTGAGCCGAGCTAATAAAAAGAAACC
TGGGATGCCGAATGTAGCCAATGACCTTTCTCAGAAGCTC
TACGCCACCATGGAGAAACACAAAGAGGTGTTTTTTGTAA
TTCATCTGCATTCTGGGCCCATAGTCAACTCCTTATTACC
CATCCTTGACTCTGATCCCCTGCTGAACTGTGACTTGATG
GACGGAAGAGACGCCTTTTTGACATTAGCACGGGATAAGC
ACTGGGAGTTCAGCTCTTTGCGGCGCTGCAAGTGGAGCAC
CATGTGCATGCTGGTGGAATTGCACAACCAGGGCCAGGAC
CGCTTTGTCTACACCTGCAACGAATGTAAACACCATGTCG
AGACACGCTGGCACTGTACGGTCTGCGAGGACTTTGACCT
GTGTATTAATTGCTACAACGCTAAGGGACATGAGCACCAG
ATGGTTAAGTGGGGTCTGGGTCTGGATGATGACAGCAGTA
GCCAAAGTGGTGAGGCCTCCAAGAGTCCTCAAGAGAGCCG
GCGTCTAAGCATCCAGCGTTGCATCCAGTCTCTGGTGCAT
GCCTGCCAGTGCCGCAACGCCAACTGCTCTTTGCCATCTT
GCCAGAAGATGAAGCGTGTGGTGCAGCACACCAAGGGCTG
CAAGCGCAAGACAAACGGTGGCTGTCCGGTGTGCAAGCAG
CTCATTGCTCTCTGCTGCTATCATGCCAAGCACTGCCAGG
AGAACAAGTGTCCTGTGCCCTTCTGCCTCAATATCAAGCA
CAAACTGCGGCAGCAGCAGCTACAACACCGGCTGCAGCAG
GCGCAGATGATGCGGAGACGCATGGCCACTATGCAGGGTC
GAGCCATGCCTCAAAGCCTACCGTCACCACCCGCATCCAC
AGCCCCCAGCACACCCACCTCGCATCAGCAACCCAACACG
CCTCAAACGCCGCAACCGCTGCCCAATCAGCCGACTACGC
CAAACGCTGTCGTAATGTCACCAACCTATCCCAATACCCC
ACGCAATGGACAACCCCTTCCTCAAGCCTCACAGGGCAAA
CCCGGCCCACAGGCGTCCCCACTACATCAGCAGCAGTCTC
CACTCCCACAGCCACCCCAGCAGCAGCCTCCGCCGCAACA
ACCTCCGCAGCAGCAGCAGCAGCCTCCACCTATGGCAGTC
AAGATGGCACGGCACATAGAGATGGTGGCGCAGGCTCAAC
AGAACTATCGCATGACCATGAATGGCCTTCCCATGAACCA
CCAGCAGCCGCGCATGCCAGGTGCAATGCAACCACCCATG
CAGCTTGTTGGGCCACGCGGGCAGCAGGTCATGCAGCCCA
TGCCGCAAGGACAGTGGCCTGGAGGCGCTCAGCCTAGTAT
GCCAGCAGCTCAGCAGCAGGTCGCTCAACAGACCCCACAG
GGCCCTCAGTCGACCTTGCCTATACAGAGACCCGCAATGC
CCCAGCAAGTTGCCCAGCCACGCATGATGGTGCCCACGCA
GGGCCCTCGACCGCAAGCACCCCAGAGAGCCGCAGGCATC
GCTCCTAATGCCTTACAGGATCTGCTACGCACCCTCAAGT
CACCCAGCTCACCCCAACAACAGCAGCAAGTGTTGAACAT
CCTCAAATCGAACCCGCAACTCATGGCAGCCTTCATCAAA
CAGAGAACTGCAAAGTACCACGCCAGCCAGCCCCAGCAGC
AGCAGCCACAGCAGGGCATACACGCAGCGCAGCCAGCCAT
GCAGAACATGGCAGCTATGCAGGCTGTGCCACGACCTGGC
ATGGCCCCTCAGCAGCAACAACAGCAGCCCACACCACAAG
GCATGGCAGCTCTTGGTCCACAGGGTCAACTCATGAACCC
TGCGCCCGCCAACAACCCTCAGTTACAGGAAATGTACCGA
CGGCAGCTTCTGCGACATCAGCAGCAGCAGCAGCAACAAC
AGCAGCAGGGAGGGATGCCTCAAGCTCATGGCCAGTTCCC
ACAGGCACAAGGAACTGCTACCAACTACACGCAACTCCGG
ATGCAGCAGCAGCAGTTGGCCATGCAGGGAACAGGTGGAC
CCATGGGCCAGCTTCCCCCAATGGCCCAGATGGCTATGGA
TGGCACACCCAACCTTTTGCACCAGCGCAACAATCTCCTA
CTACAGCAACAGCAGCTTCCGCAACAACAGGTTGTCCTCA
AGCCTCCCATGGGCTCACAGGCACAACCGAGCCCCATGAG
CCCACAAACTCACCTTCTCTCGGGCCAGCCGCAGGGCGCA
CACCTACCCGGCCAACCCATGGCTAATGCACTCAGTAATC
AGGTGTGTTCGCCAGGCCCCGTACAATCACCCAGACCTCC
GTCACAGCAGCCTCCTCCACATTCCAGCCCTTCCCCACAC
GTTCAGCCTCAGCCGTCACCCCAACATGTGCCATCCCATA
CGGGGTCACCACACCCTGGTCTGACAACACCCATGCCTGG
CTCCATGGATCAAGGACATCTGGGTACGCCCGAGCAGAGT
GCCATGCTCCCGCAGCTCAATACGCCCAATCGGGGAGGGC
TGCCCAGTGACTTAAACATGGTGGGAGACACAACAGGAGA
CACCCTAGAGAAATTTGTGGAGGGATTGTAGCGTTTACTG
GGAGACTCTACCCACCACAGTCTCCCCCTTCCTCTTTTTG
TGGCTCTGTTGTTTTGTTTTTTTCTCTAAATTCTCAATTT
TTTTGTACTGACATGTAAAAAAGTTTGAAGAAATGTATGA
AAAAAAGAAATTTATGTCGACAAGGTTAGGGAATGTTGAT
GTTTCCTAAAAAAAAATGAAAAGAGACTGATTTCTTCCTT
TAAAGAGGGAAAATTGTTGTTTAAAAGAAATCTAAATCAC
AAAGAATATATTTTTTGTTCAGTTCGGACCCTTGTGTGGT
TCATGTGTTGTTTGTTTTGTTTGGGGATGGCAGCGGCGAT
CTGGTTTCATGCCTTTTTTTTGTAAGAAAATGGAAACGTC
ATTATATCATTCATACTTTTGTTTTATACCTTATCTAACT
TTACAGCATTTTGTGTTGGAAGACTGTAAAATAACATGCC
GGGGAGTTTGAGCCAGGGTTTTCTGCTCTGTCTGTCATCC
TTCCTGGCGATTGTATTCTAGTGTTGCACTCGTTTTTTTT
TTTCATACATGCATTTGGAGTTATCTCCTTTCCTCATTGT
GAAGTTCATATGAGGAGAACTATTTGTTTGTATCGATAGG
AACTGTGCATACGCATGTATGCAAACACACACACACATGC
ATCACTCAGACAGTACTACACCGACCCCCAAGAGGATATG
TACACATTTACAACATCTCACTGGTCTGGATCCAGAGGTT
CTGTCTTGCAGATGTAGAAAATTGTTGCTTTTTTGTCCTA
ATTTTGTCATACAGATATATAAATATAAAGAGAGCTAGAG
CGAGCGAGCGAGAGAGCCTGTGGGAGAAAGCGGGGCCCCT
AAGCTGAGCGGGAGGGAATGGGCGATCACTGGTTGACTGC
TTGTTGGAATACAGAATGGATTCTGTTATTGACCCTCATT
CCTCTCACACTAACTTGAAGAGGGGCTCAGCTTTCCCCTG
TAATGTAAATCGTGCAAGTTATTAAGTAAAGTACTATAAA
TATAAGGAAGAGAGAATGGAATCACTGTATAAACTGGTTT
AAAAAAACTTATTTCTTACTTATATACCATATTGTTAAAT
AAACTGTGTGGAACAGATCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations