Transcript

ncl-003

ID
ZDB-TSCRIPT-090929-20285
Name
ncl-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040104 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040104|OTTDARG00000029258|ZDB-GENE-030131-6986 ncl|no_translation CH1073-141J18.2-003 LG_none CU469540.4,CU539057.4 Danio rerio protein_coding KNOWN, 710 bp
GACACACCTGGGCTTTCTAGAAACATCCTTGCTGGTGTGT
TGAGAGAGAGACGCCCGCACTTTATTCGTGAAGAATCTTC
CATACTCAATAACACAAGACGACCTGAGGGAAATCTTTGA
CCAGGCTGTAGATATCAGAGTACCGATGGGCAACACCGGC
ACTAGCAGAGGAATCGCCTACATTGAGTTCAAGACCGAGG
CCATTGCAGAGAAGGCTTTAGAGGAGGCGCAGGGCTCAGA
TGTTCAGGGACGCTCCATCATCGTCGACTTCACAGGAGAC
AAGAGTCGGCAGGGCGGCAGAGGTGCTCCGTCTGCAAGTA
AAGTGCTGGTGGTGAACAACCTGGCGTTCAGTGCGAGTGA
AGACTCCCTCCAGAGTGTGTTCGAGAAGGCCGTGTCCATC
AGAATACCACAGAACAACGGCAGACCCAAAGGATATGCGT
TTGTGGAGTTTGAGAATGTGGAGGACTCCAAGGAGGCGCT
GGAGAACTGCAACAACACAGATATCGAGGGCAGGAGTATT
AGATTAGAGTACAGCCAGAACGACAGAGAAAGAGGCGGCG
GAGGAAGAGGAAACTCTGGACCTACGAAAACCCTGTTTGT
CAAAGGCCTGTCAGACGACACCACAGATCAGACTCTGAAA
GACTCTTTTGATGGAGCCATCGCAGCCAGAATCGCCACAG
ACAGAGACACCGGATCATCGAAAGGGTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations