Transcript

ncl-203

ID
ZDB-TSCRIPT-090929-20284
Name
ncl-203
Previous Names
  • ncl-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040103 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040103|OTTDARG00000029258|ZDB-GENE-030131-6986 ncl|OTTDARP00000032058 CH1073-141J18.2-002 LG_none CU469540.4,CU539057.4 Danio rerio protein_coding KNOWN, 2671 bp
ACACGTGTGACTGAACGGTTCTTACCATCTCTCTCTTTCA
GTTATCAGCTTTACTGTAAAAACAGCCCTCAGTCATGGTA
AAGCTCGCTAAGAGGCAGCTAAAAAAGATGCGCCGCCGAA
GAAAAAGGCACCTCCACCTCCTAAAGAAGTGGAAGAGGAA
TCCAGCGAGGAGGACAGTGATGACGATGAGGAAGAAGAGG
CACCACCAGTCAAAGCTGTAGCGAAGAAAAACGCGGCTCC
TGTGAAGGCAGTGAAAAACGGAAAAGCTGCTGCCAAACAG
GAGAGTGAGGATGAAGATGACGACGATGAAGATGATGAAT
CTGAAGAGGAAGCTCCGCCTCCAAAGAAGGCCGCTAAAGC
TCCAGCTAAAGCAGCAGCTCCTGCAAAGAAAGCAGCTCCT
GCTGAAGAGTCCAGTGAAGAGGATGACGACGATGATGATG
ATGATGAATCCGAGGAAGAGGCTCCACCTCCCAAGAAGGC
TCCTGCCAAAGCTACACCAGCTAAAGCCACACCAGCCAAG
AAAGCAGCTCCCGTGAAGAAAGCAGCTCCTGCTGAGGAGT
CTGAGGATGACGATGATGATGATGAATCTGAAGAGGAAGA
AGCTCCGCCTCCTAAAAAAGCTGCAGCAGCGGCTAAACCT
GCAGCTAAAGCACCTGCAGCCAAAGAGGAGTCAGATGAAG
AGGAGGATGATGACGAAGAGGAGGATGGTGAATGATGATG
ATGAGGAGGAAGAAGCCCCGGCCACTCCAGCTAAGAGGAA
AGCCGAGACCAAAAAAGAGAAGGGAACGCCGCCGGCTAAG
AAGGCTAAAACCGATGGCGAGGGTTTCAGTCTTTTTTTGG
GCAACCTGAACAACAATAAAGACTTTGACGAACTGAAGTC
GGCTATCTCAAAGTTCTTCTCAAAGGAGGGCCTTGAAATT
CAGGATGTGCGACTTGGTGGAACAAAGTAAGAAATTCGGC
TACGTTGACTTCGCCTCAGAGGAAGAGTTGCAGAAGGCTT
TAGAGCTCAATGGCAAGAAGTTATTGGGTCAGCCAGTCAA
ACTGGACAAAGCCAGAAGCAAAGAGAACTCGCAGGAAAAC
AAGAAAGAGAGAGACGCCCGCACTTTATTCGTGAAGAATC
TTCCATACTCAATAACACAAGACGACCTGAGGGAAATCTT
TGACCAGGCTGTAGATATCAGAGTACCGATGGGCAACACC
GGCACTAGCAGAGGAATCGCCTACATTGAGTTCAAGACCG
AGGCCATTGCAGAGAAGGCTTTAGAGGAGGCGCAGGGCTC
AGATGTTCAGGGACGCTCCATCATCGTCGACTTCACAGGA
GACAAGAGTCGGCAGGGCGGCAGAGGTGCTCCGTCTGCAA
GTAAAGTGCTGGTGGTGAACAACCTGGCGTTCAGTGCGAG
TGAAGACTCCCTCCAGAGTGTGTTCGAGAAGGCCGTGTCC
ATCAGAATACCACAGAACAACGGCAGACCCAAAGGATATG
CGTTTGTGGAGTTTGAGAATGTGGAGGACTCCAAGGAGGC
GCTGGAGAACTGCAACAACACAGATATCGAGGGCAGGAGT
ATTAGATTAGAGTACAGCCAGAACGACAGAGAAAGAGGCG
GCGGAGGAAGAGGAAACTCTGGACCTACGAAAACCCTGTT
TGTCAAAGGCCTGTCAGACGACACCACAGATCAGACTCTG
AAAGACTCTTTTGATGGAGCCATCGCAGCCAGAATCGCCA
CAGACAGAGACACCGGATCATCGAAAGGGTTTGGTTTTGT
AGACTTCGATAACGAGCAAGACTGCAAGGCAGCTAAAGAA
GCCATGGATGACGGAGAGATCGACGGAAACAAAGTGACTC
TGGACTACGCCAAGCCCAAAGGAGAAGGTGGACGAGGAGG
ATTCGGCGGAGGAAGAGGAGGCTTTGGAGGACGAGGCGGC
GGAAGGGGTGGATTTGGAGGTAGAGGAGGAGGAGGACGAG
GTGGCGGATTCAGGGGAGGACGAGGAGGAAGAGGCGGCGG
CGGAGGATTCAGAGGAGGAAGAGGAGGAGGAGGCCGAGGT
GGATTCGGGGACAGACCACAAGGAAAGAAGATCAAGTTTG
ATGATTAAAGGTTTCACTGAATGAACTGTTTTCACTGCTT
AAATCCTCGTTGTCAGAGCGTTTCTAGGACATTCCAGAAG
GTCCCGGTGATGTACAGAGCCCCCCGTCCCCCTCGCCCCT
TTAACTGTGTGAGTTCTGCAGTGTCCCGCCATCCCTCAAC
ATTAATGTGAATGTTGTAATAATGCTCTGCTGGTTTAGGT
ACATGTTGTACATGCAACAGTTTCTTTTCCCATTTCTCTT
TTTTGTTACAGTGTCTATTCCTCCCTCTCTCCTCACTTTA
TTTCAAACCCAATTTTTATTTAATTTGTTTTTTTAAGTTT
GCTTTAGGGTGCCAGATTAATGTGCAGTACCTTTTTAATG
TGCAAAGCATATTGTAACGTATGCATAATTGACTCCTGTT
TAGTATTTAGAGATGTAAATCTGTATGAAAAAAGATTGAA
TGGGATACAGACCGAAAACAGCACGTGTTTTGTGATGTCA
AATTTATATGTAAATTAAATTTGGCTTTGACTTTAGGGTT
TTTCTTTTCCTCCAGTTCAGATTTTTTCATGATGTAAAGA
ACCATTTTGATTAAATATGGTTTTTAAACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations