Transcript

vegfab-201

ID
ZDB-TSCRIPT-090929-18995
Name
vegfab-201
Previous Names
  • vegfab-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038629 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038629|OTTDARG00000007753|ZDB-GENE-030131-4605 vegfab|OTTDARP00000030948 vegfab-003 LG_ BX324164.15 Danio rerio protein_coding KNOWN, 600 bp
CAAGTCTCTCTGCCGTCCTCGGGAAATGTTGGTGGAAATT
CAGCAGGAGTACCCTGATGACACAGAGCATATCTTCATAC
CGTCCTGTGTGGTTCTCACCCGCTGTGCTGGGTGCTGCAA
TGATGAAATGATGGAATGCACCCCCACCGTCACATACAAC
ATTACCTTGGAGATTAAGAGATTGAAACCTCTTCGTCATC
AGGGTGACATTTTCATGAGTTTTGCTGAACACAGTGAATG
CCAGTGTCGGATGAAAAAAGATCTTCCAAAGGAAATAGAA
AATAGTCAGTGTGAGCCTTGCTGTTCTACATGTTCTGAAA
GAAGAAGAAGGTTGTTTGTTCAAGACCCAGAGACATGTCA
GTGCTCCTGCAAACACTCTGAAGCCGACTGCAGGTCTAGG
CAACTAGAACTCAACGAAAGGACCTGCAGGGACCTGTGAC
CCTATTGTGTGCTGCGCTGGGGGCCGATGTCATCACCGAG
GGCCCCAGAGATGGAAAAATGACAGGAGGCCTATGGTTTC
TGGCTGTAACGCGACCCTGCAGATGCTCCAGTCATGCCTG
CTATGAGAGGCCTCCGCATGGGCCTCAACCCTCTGGACGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations