Transcript

vegfab-202

ID
ZDB-TSCRIPT-090929-18994
Name
vegfab-202
Previous Names
  • vegfab-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038628|OTTDARG00000007753|ZDB-GENE-030131-4605 vegfab|OTTDARP00000030947 vegfab-002 LG_ BX324164.15 Danio rerio protein_coding KNOWN, 2198 bp
CTTTGCTGTTCGCGTGCTCCAGTTATTTATTGTGACGCTT
CTGTATTTTTCAGCTGTCAAGAGTGCCTACATACCCAGAG
AGGGAGGCAGAAGCACATATGACGTAGTGCCATTCATGGA
GGTGTATAACAAGTCTCTCTGCCGTCCTCGGGAAATGTTG
GTGGAAATTCAGCAGGAGTACCCTGATGACACAGAGCATA
TCTTCATACCGTCCTGTGTGGTTCTCACCCGCTGTGCTGG
GTGCTGCAATGATGAAATGATGGAATGCACCCCCACCGTC
ACATACAACATTACCTTGGAGATTAAGAGATTGAAACCTC
TTCGTCATCAGGGTGACATTTTCATGAGTTTTGCTGAACA
CAGTGAATGCCAGTGTCGGATGAAAAAAGATCTTCCAAAG
GAAATAGAAAAAAAACCCCGGAAGGGCAAAGGCCAAAAGC
GAAAGGGAAAGAAAAACCGTGAAAAAAAGCGGGATTTGTG
CATGGCCCCATCCTGCCTAACTTCAGCTATTCACACTCTA
CAACCGTCCCTTTGGACCCTCAGAAGGGGCAAAACCGTGG
TTCCAGACCAGGGTGGCTCAAAAATTAGTCAGTGTGAGCC
TTGCTGTTCTACATGTTCTGAAAGAAGAAGAAGGTTGTTT
GTTCAAGACCCAGAGACATGTCAGTGCTCCTGCAAACACT
CTGAAGCCGACTGCAGGTCTAGGCAACTAGAACTCAACGA
AAGGACCTGCAGATGTGACAAACCAAGGAGGTGAACCGAA
CTGACTTGAGAACGGACATGAAGGAATATTTCACCAATAA
TTCACAGCACTTTGAACTTTTTCAGCTTTGAACTATGTGT
CTCATTTTTCCACCGTGGAAATATCGAGAGAATGAAGTGA
AGTGGTTGGAGATGGATGTGGGAGGGTTTAGTAGTCAATG
AAATGTCTGTTTGTATATTTTCATGATTTTCATGTGTGTG
CTAAGCAAACCGAGAGACTCGGAGCACAGGATTTGATTTG
CTGCTAAAAGGTCTTCAGACCTGCGTAAATGTTTCTGATC
TTGGCTGGTGTGTGTAAAGTCATACCCGCGTTCACTCAAT
GAAACACATCACTGGATTTGGGTCTGCTGTGCAGTTTGTT
TTTGTGAATCTAAATGTAAACAAGTGCAAACAAGTTGTTT
GGAAGACTAATGCGTCAGCGTCCACTACGCGCTGTGGAAT
CATTCCTCCCAGTACATGAACAATGAGCACAACGTGTGTG
TTTTTAGAGACAGACGATTGACTGGAGTTTCAACGGAAAG
CGAACTGATTCTGCCATTGGAATGTCACAGTGGAAACCCG
CTGCCTGCTGTGGTAAATGTTTGCACCAGAGCTCTGACCT
TGACGAGGCAAACCCTACAGAATTTCGGTCGTATTCACTC
CTTAAAGGGATATTCATTCTTTGACATGCTTGGAAACCAC
TTTTGAGTAAATCCTGTGATTTAGATTCCATGTTTCCACA
CTACTGGGGATTTAAGATGACGATTTTGTGCTACGCTTTC
GTTGTCGTTTCAGCTCGTCTTGGAATTTTAGTCCAAATCT
ATTCCCCCTCCAAACAATTCAGTAATTTATAATTTTTTTT
TAGAATATTTTCAGTGTTTTTTCTCTTTGTATTTAATTTG
ACCTATTTATGTGCAGTGTTATTCTTGCCCCATTTTGTCT
GCAAAACTCCACACTGTTGTTCTGAGAAAAAAAAGCTTTT
ATTTTCCGTAGCTGAAAAGAGAAACATTCCTATTACTGAT
CAGTGAGTTGTGTTGCCAACTGCCTTGACTTTGCTGCCTC
TCTGCACATGTGTGTGTGTGTGTGTGCCGTGTGAGCTCTA
ACAAACAAACTGTAAATGTGATTTGGTGTGGATACGAGGT
TAGTGTTTGTGCGCGTGCACGTGCGAGTATGTTTTGGCGA
AACACTCTTGATGTCAGTGTGACATACATATTGAATAACA
ATATAGCAGCCAAATGTAAATATAGGCCAAACCCACGTCA
CCATTTACTTCTACTATAATAAGATCTAACAAGCTGAAAC
AGTATGCTGAGGTGTGGTCTGATTCGATTGGAGTTTTACA
GTTTAAACATTATTTATTTACTCTGTGTATGTAAATATGT
TGAATATTAACTTTTTTCGTGTCTGTAATGTAGAACAGCA
TATTTATTTTCAAATTATATTGCTCTTTTTCTATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations