Transcript

nr4a3-201

ID
ZDB-TSCRIPT-090929-17749
Name
nr4a3-201
Previous Names
  • nr4a3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037326 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037326|OTTDARG00000027662|ZDB-GENE-070824-4 nr4a3|OTTDARP00000029907 nr4a3-001 LG_ CR524821.5 Danio rerio protein_coding KNOWN, 3244 bp
ATGCCCTGCGTTCAGGCCCAGTACGGCCCTCCACCCCATG
GGTCCAGCTACTCTGCCCAGTCCTTTGGCTACCATGGTGA
CTACAGCGCTGACCTCATGGCGACAGACTACACAAAGTGT
GAGCTCAGTGGGGGAGAGATCTCAGCGGCGGCCGCCACCA
CTTCCTTACCCAGTTTTAATGTGTTTGTGGAGGGCGGCTT
CGAGCCCAAACCTTCCTGTCTGTATCAACTCCCTCCTCAA
CGCCCTATCATCAAGAAAGAGGAGGAGTCCTTCCCACCCA
TGGCACCATCTGACGAAGCAATACCTGGGAGCTCCATGTA
CTTTAAACAGTCGCCCCCTTCGACGCCCCCTACGCCGCTT
CACCCCGGCCCACCCAGCAGCTCTTTCTTGTGGGATGAGC
ACAGTCTTCCCCCAGTGCCCCAACCTTGCCTGATTGAAGG
CCCGCTGAAGAGCCCTCGCTTCCCTCATTTCTACGAGCAG
ACGGTGCCACCCTCCACCAGCGGCTACGACACTGCCATCG
GCCTTCCGCTGCGCCCTGAACGCTCTCCTTCGTCCTCCTC
TTCGTCTTCACATGTGCCACCCAACATGGACACACATGCA
CACTCACACGTGCACTCCCATACGCACTCAAACATGTACC
CGATCAACATGGGTAAGCCGGGAGGCCTGGCGTTTCGCTC
TCTGGGCATGGGCCACTGTCCACCGCTTCTGGGAGAGAGT
TTGCCATCGCCGCCAAATCGCACCAGCTCTGGAGAAGGAA
CCTGCGCGGTTTGTGGAGACAACGCAGCCTGCCAGCACTA
TGGCGTACGCACTTGTGAGGGCTGCAAAGGCTTCTTCAAG
AGGACGGTGCAAAAGAATGCAAAGTACGTGTGTTTGGCCA
GTAAAAACTGCCCTGTGGACAAAAGGAGAAGAAATCGCTG
CCAGTACTGCCGTTTCCAGAAGTGCCTCAGTGTAGGCATG
GTGAAAGAAGTGGTGCGCACAGACAACCTGAAGGGCAGGA
GAGGTCGCTTGCCATCTAAACCAAAGAGTCCCCTGCAGCC
GGAGCCGTCGCCCCCATCGCCTCCCCTCAGCCTGCTGAAC
GCACTGGTGCGCGCTTATTCCCAGTCCACACCACGAGAGC
TAGACTACAGCCAGGTAACTGATGCGGTGGAGCCCGTGGG
TCTGTCTGAGTCTCAGCAGATCCAGATGTTTTACAGAGTG
TTAACCGGCTCTATGGAGGTGACGCGCTGCTGGGCTGAAC
GGCTGCCTGGATTCTCTGAGCTTCACCACGACGACCAGAA
CATGCTGATTGACTCTGCCTTCCTTGAGCTTTTCGTGCTT
CGCCTCGCCAACAGGTCTTTGCTGGTGGATGAGAAGTTTG
TGTTTTGTACGGGGCTGGTCCTGCACCGGCTGCAGTGTCT
GCGTGGCTTCGGAGAGTGGCTAGACTCTATTCGAGACTTC
AGTGCCCACCTCCAGGAACTCAACCTCGACATGCCTGCGT
TCTCCTGCTTGTGCGCCTTAGTGTTGCTAACAGAACAATG
TCCCGGTCTAAAGGAGCCCAAAAAAGTGGAGGAGCTGCAA
TCCAAACTGATCTGCTGTCTGCGAGACCACCTGAACTCCA
TCAATGCTGGAGGTGTGGCTTCCACCGGCAAGGCCCCACC
CCCAGTGGGGGCTGTGCTGGGCTTAAGGGCGGAGCTTCGG
TCTCAGCGTACGCAAGGCCTACAAAGGATCTTCTACCTGA
AGCTGGAGGACCTGGTCCCACCCCCACCACTCATCGATAG
GTTCTTGGACACCTTGCCCTATTGATGGCCACGCCCACAT
TTTTTTGCACACTCGCTCAGACACGCCCACAGCGACTATA
AACTCACCCTGGGAGGGACAGAGCCAGTAGCTAACAGTGA
CACTGAACTCGATTTGCCCCAAATCAAACGTGTCTGAGGA
GAAACCAATCATATAAGCGCTTTTAATCTCTGCTCTGCGC
CTGATAATGTAGATACAAGCCAGGGTTTGAGTGTTTCTGA
CGTACAGTCTATAGCTCAGCGAGTCACGTCAGTAGAAGTA
TTACTGTGTGTGTATGTGTGTATGTGTGTGTGCATGTGAA
GAAACACCCTTTACGGCTTCATCGCAGGTGGTCCAAATGT
TTCCACCACAATCCACCTCAATGACAGCAGTGGTGTTCAT
CACAAACATACACTCACAGACACACAAGTGCACGCGAACT
GTCCTTTCACACATACGCACGGAGCTTCAGATGCCAGATT
ATGACATATCAACTGTCATTGGCAGAAACGAAGTGGATGT
GTGTGTGAAAACGCGTAGGAGGCTTTCGCCACACAGAGTG
CATTAATGTCCAGAATCACAGTTGATCGCACCCCGAAAAT
CCTGCAAACAAGTGCAATTTACTAAGTGCTATTGTAAACG
TCGCGGGAGAGAACGAGAAAGCGTGTTTGTTCCAGTCCTA
TTTCAAACTCTAAATTATTTTAATACTAAGACTTTGCCTC
GTAAGGCTGATGGATTTTGATTGAGAAGATTTAGCCCAGT
CTGCGCACTAACTTTTTAAACGACGAAGTTCCACAGACTT
GAAATCAAAGTAGGGTTTGTTTTTGTTTTCATTATTATTG
TGAAGAAAAACCAAGGGATTTTAGCCTTAGGACTAAAAAA
AAAAAAGTAGAACTGGGCTTTAAGCACTTAAAAAAACAAC
AGGAAGTGGATCAGGTGAGGTGCAGGTGCAGAGAGAGGAT
GGAAGGAATGAAACATTCCGCGTTCATGCTCATTTTTGTA
TGTTTATACTGTCTACGCCATTTATTAATATGGAGGACAT
TGTTGCAAAAAATGTCTTTTGTATGTACAAAAAAAGTAAA
AACGGATTATATGCATGGTTTTCTCCTTCTCGCCTCTGCT
TGTATTTATTTTGCAAAGACTGCCGGCTCCACAAGGGCTT
GAACACACTTACTGACTGGGCGTTCTCGCTTACTTTATCA
TATGGCAGCGGTTTGAACAGATGAGAAAGTACAAATTCTA
TAAATATATAAATATATATATATACACAATACAAAACTAA
TATTTTGAAGTGTTTTTATCTGATAGCTTTTTCAAATCTT
GTGGTACAAGTTGTGAATTGTTTTTTTGGAAAAGAAACAT
GAAAAAAAGAAAAAAAAACGTTTTTCAATGTCTTTTTTTT
TTTTGGTTTTAGTTTTTTTCTCTTTGGTTCACTGGAGGCT
CTGTTTAGCACTTTGAAATCATAAAAAAATCTTCTGATTA
TTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations