Transcript

nr0b1-201

ID
ZDB-TSCRIPT-090929-17740
Name
nr0b1-201
Previous Names
  • nr0b1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037317 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037317|OTTDARG00000027657|ZDB-GENE-070130-1 nr0b1|OTTDARP00000029901 nr0b1-001 LG_ CR352256.11 Danio rerio protein_coding KNOWN, 1457 bp
AAACTATTTGCCATTTGGGTGGACGGTAACACAGACCTCA
GCCGTGCATGGACATCTCCAAGCGTGCAGCTCAGCACAGT
TTCAGCAACGAAACATAAGCAGCTCTGCGAGGATGGCTTA
CTTTGACAGCGGCTGCCACTGCAGCAGCGAGCGGCGGCAG
AACAGCATCTTATACAGCATCTTAAAGAACGACAGTCAGT
CTGCGCAACTTGGGAACCAGCCGCGCGCCCCGAGGCTAGC
CGTGTCCATGCGCGCCTGTGCCTGCGGCTCCAAGAGGAAA
GTGTCCCTCCGTTCTCCTCAAACCACATGCAAAGCCGCCT
CCGCCGTCCTGGTCAAGACCCTGAAGTTCGTGAAGAACGT
CCCGTGCTTCCGCGAACTGCCAGCGGATGATCAGCACACG
CTGGTGCGAAGCGGCTGGGCACCGCTGCTGGTGCTCGGTA
TGGCGCAGGACAGGATCGACTTCGAGACTTCGGAGACGCA
GGAGCCCAGCATGCTGCAGCGGATTTTAACGAGCGGACAG
GACAAGCAGGACAACCAGAGCCATAACGGCGGAGTGGCGT
TGACCGACGTGCAGGGTATTAAAATGTTTCTGAGGAAATG
CTGGGGACTGGACATAAGCACTAAGGAGTACGCGTACTTG
AAAGGGGCCATTCTGTTCAACCCAGATGTTGCTGGGCTGC
AGTGTCAACATTACATCCAGGCCCTGCAGAGCGAGGCGAA
CCAGGCACTTAATGAATATGTCAAAATGATTCACCGCGGG
GACAGTGCGAGATTCGCCAAACTCTTCCTCGCTCTCTCCA
TGCTGAGATCCATCAACGCCAATGTAGTGGCTGGGCTCTT
CTTCAAACCCGTCATTGGCGCGGTCAACATGGAGGAACTT
CTTCTGGAGATGTTTTATGGAAAATAAACTTTGAAAAAAA
CTGGGAGAGAATTATCAGACTTGGAAAGAGCGACAGTCAC
TGTTGGAGGGACAGATTTTGAAAATGACTGATTCCTTTTT
ACACATGCTATTTTTGTACAATATATAAGAGCTCTCCTTT
TTGCCTTCTGAGTTGAACTCATCACTGAATCCAAAGTTGA
TGACAATATTTTTCCCATTTGGGGAAAGAGCTTTATAACT
TTGTTCTGATTGTTTTTTGTTTACTTGCTTATTATCTGTA
ATGTCTTGTTGCATTTTGAAGAATGTTTATTTGATTCTGG
GAGACACTTTATAATAACTTTCTTAAGGAAATCATTTACA
AACATTCATTTAAATATGTGCTCCGTTTAAGAAATACATT
GAAATGTAATTATATTTGATGTAAATATATTACATTTAAT
AATAGCCTAATATATGATCTTATGTTTCCTGATATTATTT
GTTATCTCATGAACTGTTTTGCATTATTAAATGTAATGAT
TTTGTTGTTGTAAATGAAAGTTATTATAAAGTGTAAGCTA
TTTTTGAAAATTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations