Transcript

atp6v0ca-201

ID
ZDB-TSCRIPT-090929-16866
Name
atp6v0ca-201
Previous Names
  • atp6v0c-002
  • atp6v0ca-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036369 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036369|OTTDARG00000027140|ZDB-GENE-020419-23 atp6v0ca|OTTDARP00000029183 atp6v0c-002 LG_ CR387933.10 Danio rerio protein_coding KNOWN, 1522 bp
AGAAGCGGAAATGGACCCTGCACTCATGTCTTGATCATGT
GACTCTCTTCATTTCGCCATTTTCTTCCTCTCCGCCGGCG
ACCAGCCTCCTGTCGGTTTTAGTCTCCCGAACGCGCGAGA
AGAATGGACACCCAGAACCCCCAGTACTCTCCCTTCTTCG
CAGTGATGGGTGCCTCCTCAGCGATGGTGTTCAGCGCGTT
GGGTGCTGCATACGGGACTGCTAAGAGCGGCACAGGCATT
GCTGCCATGTCAGTGATGCGGCCAGAGCTGATCATGAAGT
CCATCATTCCCGTGGTCATGGCGGGTATCATTGCCATCTA
CGGCCTGGTGGTGGCTGTACTTATTGCCAACAATATCGGT
GATAAAATCTCGCTCTACAAGAGTTTCCTGCATCTGGGAG
CGGGTCTGAGTGTGGGTCTGAGCGGTCTCGCTGCCGGCTT
CGCCATCGGGATCGTGGGAGACGCAGGTGTGAGAGGAACG
GCCCAGCAGCCGCGTCTGTTCGTGGGCATGATCCTCATCT
TGATCTTTGCAGAGGTGCTGGGGCTCTACGGCCTGATCGT
CGCCCTCATCCTGTCCACTAAGGGTTAATCGTTGCTCCTA
TCCTCTCTTACACATGAACAAACACACACACAGACACACA
CACCAACACAAATGATATACAACGAGTAAACTTCACCGCC
TGAATAACGACGAGAGGAATTTTTGCGTGCATGCGTGTAT
CGTGAGTGTGCTGTTTGCGATGAGTGAGCGTGAGATTGAT
CTTCCTCTCTGTGTAAAGTAGCCCGATGTGTGTGTGTTTT
TCTTTCCCCCCTGTAAATGCGCTGTGTAGCTATCGCTCTC
GTCCCGTGTGTGTGTGTGTGTGCGTGCGTGTGTTTAAATA
TAGACGCCCTCTTTCTCATACGCTACACTTTTTGTTTGTC
ATCCTCTTTTATTTAGTTATAATTTTACTCTCCTTTAAAG
AACAAATCAACTGTTTTTGTTTAGTTCGTTTCTCACTTTT
GGGACCATTCATTCCAATTATTAAAACACTGATGTTGAGG
ACCTAAATGTAAAAAAAAAAAGATGGATTATTGCTGTTTG
TTTGTTTTGTTTTCTGTTCCTGATGATTATTTATGAAGAT
TTTGAGATGTTCATTAAACAGTTTAAGTGGATCAAAGTCT
TTATCGAGAATCCTGACTATATATAAATGGTGTGAGCGTG
TATCAGAAAATATATATATGAATATATCTGTATAGGTGAG
TTGCACTGTGGAAAATTTGTCAGTTCTTCGGGTATGTAAT
CACTGATTGCCATTGAGAGAGTTGTCTTAATCAAGATATA
GATGTGCAAGTTTAGTACCTGTGTGTGTGAAACGAATGAA
TGCACATGTGTGTTTGTGAGAGCGCATGTGTGCGTGTGTG
TTTAAACGTGACATTTCTTCTTACATGTAGCGTTTTACCT
GTAGTTGATACTGTTTCTGGGTCCGTTCATGGGTGAACAC
CAGCGCAGCTTGTCCAGTTTCCGAATAAAACTTCCTCAAC
CT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations