Transcript

atp6v0ca-202

ID
ZDB-TSCRIPT-090929-16864
Name
atp6v0ca-202
Previous Names
  • atp6v0c-001
  • atp6v0ca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036367 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036367|OTTDARG00000027140|ZDB-GENE-020419-23 atp6v0ca|OTTDARP00000029181 atp6v0c-001 LG_ CR387933.10 Danio rerio protein_coding KNOWN, 1237 bp
TGATCATGTGACTCTCTTCATTTCGCCATTTTCTTCCTCT
CCGCCGGCGACCAGCCTCCTGTCGGGTTCGTGACCGTCTC
TCCTGCTCCTGCAAGACCTGTCAGCCAAAAGAAGACCTCA
CTCAGAGTCTAAACCTGCTAGACTGAAGCTTTCCTCCCTT
TTCTGCCTTTAGTTTTAGTCTCCCGAACGCGCGAGAAGAA
TGGACACCCAGAACCCCCAGTACTCTCCCTTCTTCGCAGT
GATGGGTGCCTCCTCAGCGATGGTGTTCAGCGCGTTGGGT
GCTGCATACGGGACTGCTAAGAGCGGCACAGGCATTGCTG
CCATGTCAGTGATGCGGCCAGAGCTGATCATGAAGTCCAT
CATTCCCGTGGTCATGGCGGGTATCATTGCCATCTACGGC
CTGGTGGTGGCTGTACTTATTGCCAACAATATCGGTGATA
AAATCTCGCTCTACAAGAGTTTCCTGCATCTGGGAGCGGG
TCTGAGTGTGGGTCTGAGCGGTCTCGCTGCCGGCTTCGCC
ATCGGGATCGTGGGAGACGCAGGTGTGAGAGGAACGGCCC
AGCAGCCGCGTCTGTTCGTGGGCATGATCCTCATCTTGAT
CTTTGCAGAGGTGCTGGGGCTCTACGGCCTGATCGTCGCC
CTCATCCTGTCCACTAAGGGTTAATCGTTGCTCCTATCCT
CTCTTACACATGAACAAACACACACACAGACACACACACC
AACACAAATGATATACAACGAGTAAACTTCACCGCCTGAA
TAACGACGAGAGGAATTTTTGCGTGCATGCGTGTATCGTG
AGTGTGCTGTTTGCGATGAGTGAGCGTGAGATTGATCTTC
CTCTCTGTGTAAAGTAGCCCGATGTGTGTGTGTTTTTCTT
TCCCCCCTGTAAATGCGCTGTGTAGCTATCGCTCTCGTCC
CGTGTGTGTGTGTGTGTGCGTGCGTGTGTTTAAATATAGA
CGCCCTCTTTCTCATACGCTACACTTTTTGTTTGTCATCC
TCTTTTATTTAGTTATAATTTTACTCTCCTTTAAAGAACA
AATCAACTGTTTTTGTTTAGTTCGTTTCTCACTTTTGGGA
CCATTCATTCCAATTATTAAAACACTGATGTTGAGGACCT
AAATGTAAAAAAAAAAAGATGGATTATTGCTGTTTGTTTG
TTTTGTTTTCTGTTCCTGATGATTATTTATGAAGATTTTG
AGATGTTCATTAAACAGTTTAAGTGGATCAAAGTCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations