Transcript

pparab-201

ID
ZDB-TSCRIPT-090929-16745
Name
pparab-201
Previous Names
  • pparab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036241 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036241|OTTDARG00000027080|ZDB-GENE-990415-211 pparab|OTTDARP00000029085 pparal-001 LG_ CR354430.16 Danio rerio protein_coding KNOWN, 1590 bp
AGCTGCAGTTTGACAGCGGCGGAGGTGCGTCGAGTGTCGG
CGGAGGTTATTATGCGTTTGTGGAAATGTTATAAATGATA
TTTGTCTGCAGTGAGCGGCGGACGGCACCGCTACCGGATC
CTGGACGCCCCGAGACGCGATGTTTGACCAGCAGCGGCCG
GTAAACCTAAAGGCTGATGTGTGACTGGCGCCCGGCCCCT
GTCCGCCAGCATGGTAGACATGGAGAATCGCTACCGTCCT
CCGTCTCCGCTGGACGACTCTGTGCTGGACAGTGCGCTGT
TCGTCAGGGGAATGGAGGAGCTGCGGGACATCTCTCAGTC
CATGGATGAAGACGCTCTCAGCAGCTTCGAGATGACCGAG
AACCAGTCCGGTCTGGGCTCTGGATCCGAGAGCTCCACCG
TGCTGGATGCTCTGACCCCTGCGTCCAGCCCGTCGTCAGG
TGTGTACGGTTGCCCGGTGGGTCAGGACGAGTTCACCTCC
ACCTCTCTGAATCTGGAGTGTCGTGTGTGTTCGGATCGGG
CATCAGGATACCACTATGGCGTTCATGCATGTGAGGGCTG
CAAGGGTTTCTTCCGTCGGACCATTCGGCTCAAACTGGAG
TACGATAAGTGTGAACGCCGCTGTAAGATCCAAAAGAAGA
ACCGAAACAAGTGCCAATACTGTCGATTTCAGAAGTGCCT
GTCCGTGGGCATGTCCCACAATGCCATCCGTTTTGGGCGA
ATGCCACAGTCGGAGAAGCTAAGGTTGAAGGCAGAGATCC
TGACAGGAGAACGAGATGTCAAAGATGATCAGAAAACCCT
GGCCAAGCAGATCTATGAGGCCTACGTCAAGAACTTCAAC
ATGAACAAATCCAAAGCACGAACCATCCTGACGGGAAAGA
CAAGCACGCCGCCCTTTGTGATCCATGACATGGAGACTCT
TCAGCTGGCAGAACAGACGTTTGTGGCCAAGATGATGGGC
TCTTGCGGAGGTCTGCTGAACAAAGACCCTGAGGTGCGCA
TATTCCACTGCTGCCAGTGCACTTCAGTCGAGACCGTCAC
CGAACTGACCGAATTCGCCAAATCTGTGCCCGGATTCTCA
AACCTCGACTTAAACGATCAGGTAACGTTACTGAAGTACG
GTGTCCATGAGGCTCTGTTCGCCATGCTGGCCTCCTGCAT
GAACAAAGACGGTCTTCTGGTGGCGTACGGCAGTGGCTTC
ATCACCAGAGAGTTTCTGAAGAGTTTGCGGCGGCCCTTCA
GCGACATGATGGAGCCCAAGTTTCAGTTCGCCATGAAGTT
CAACTCTCTAGAGCTGGACGATAGTGACCTCGCACTGTTT
GTCGCTGCCATCATCTGCTGTGGAGATCGTCCCGGTCTGG
TGAACGTCCCGCATATCGAGCGAATGCAGGAGAGCATTGT
TAACGTTCTCCATCTGCACCTGAAGAGCAACCACCCGGAT
CACGGCTTTCTGTTCCCCAAACTCCTGCAGAAGCTGGTGG
ACCTGCGTCAGCTGGTGACCGAACATGCACAACTCATACA
GGAGATCAAGAAAACGGAGGACACGTCGCTGCATCCGCTG
CTGCAGGAGATCTACAGAGACATGTACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations