Transcript

pparaa-201

ID
ZDB-TSCRIPT-090929-1434
Name
pparaa-201
Previous Names
  • pparaa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009257 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009257|OTTDARG00000008127|ZDB-GENE-041210-169 pparaa|OTTDARP00000007983 CH211-239E6.3-001 LG_ BX649425.3 Danio rerio protein_coding NOVEL, 1953 bp
CTCGAGTCAAATCTACAGAGTGGAGAAATCAGGTACAACT
TTAGAAAGCTGGACAGCTTCCTCTAACAGACAAAGCTGGA
AAATGTGATTCTCTGCCAAATGCTGATTTATGACCAGATT
CAGCAGGAACAGCTTGTCTACCTTCTACTACTTTTTTTAG
CACAGATGACACTGCAGCAGAGACTGATGATTGATTCAAA
TCTTGCCGTGGTCCAGCGCCATGGTAGATATGCCGAGCCT
CTACAGTCCCTCGTCCCCTCTGGGAGACCCGATTATGTAC
AGCCCTCTGAGCGGAGAGCTCATTGGTGACATGCAGGTGC
TGGAGGACATCTCTCAGTCTCTCAGCGACGACACCTTCAA
CTCCTTTCACATGCTGGACTACCAGAACTGTGACACTGCA
GTAGACAACTCATCGATATTAGATGTCTTAACTCCGGCGT
CTAGTCCGTCCTCAGAAGTGTTCTCAGCCAGCACGGGTCA
GGACGAGAACTCATCCGGATCTCTCACCCTCGAGTGCCGC
GTCTGTGCCGACCGGGCTTCAGGTTTCCACTACGGAGTGC
ATGCCTGTGAAGGGTGCAAGGGCTTCTTCAGGAGAACCAT
TCGACTTAAACTGGAGTACGACAAGTGTGAACGCAACTGC
AAGATCCAGAAGAAGAACCGAAACAAATGTCAATACTGCC
GATTCCGCAAGTGCCTTGCAGTGGGCATGTCCCACAACGC
TATTCGTTTTGGGCGGATACCCCAGTCCGAGAAGCAGCGT
CTGAAAGCGGAGCAGGACGTCAGCGGGAAAGAGGAACACA
AATGTCAGCAGCCGGACATGAGGAGTCTGGCCAGACAGAT
GCACGAAGCCTACCTCAAACACTTCCACATGAACAAAGCC
AAAGCACGTGTGTTTCTCACAGGCAAGACCAGCACTCCGC
CCTTCGTCATTCACGACATGGACACTCTCCAGCACGCAGA
GAAGAAACTAGTCACCCAGCTGCTGGGTAACGTGGCATCG
GGCGACATCTCCACCCTGCAGGAGCGAGAAGTGGAGGCCC
GGCTCTTCCTTTTCTGCCAGTACGCTTCAGTGGCCACGGT
CACAGAGCTGACGGAGTATGCCAAGGCCGTGCCAGGCTTC
GCCGACCTGGACCTCAACGACCAGGTGACGCTGCTGAAAT
ACGGGGTGTACGAGGCGCTGTTCACTCTGCTGGCGTCCTG
CATGAATAAGGACGGACTGCTGGTGGCTCAAGGCGGAGGC
TTCATCACCCGAGAGTTTCTGAAGAGCCTGCGCAAACCCT
TCAGTGACATGATGGAGCCCAAGTTTCAGTTCGCCATGAA
GTTCAACGCTTTAGAGCTGGACGACAGTGACCTGGCGCTG
TTCGTGGCTGCCATCATCTGCTGTGGAGACCGTCCCGGAC
TCAGCAACGTGCCACAGATCGAGCGCATCCAGGAGAGCGT
AATCCACTCTCTGCGGCTCCACCTGACGTCCAACCACCCC
GACAACAGCTTGCTGTTCCCAAAACTGCTGCAGAAACTGG
CCGACCTGCGGCAGCTGGTGACGGAGCACGCGGAGCTGGT
GCAGGAGATCAACAAGACAGAAGACGCGTCACTCCACCCG
CTCCTGCAGGAGATCTACAGAGACATGTACTGAGCTCACA
CGTATGCATTCGACCAGGAGATAAACAGGAGACCGGCAGT
AACATGTTTAGGGTGTGCACCTACATCAGGATCATCGTAG
GGTACGGCCAGTGTAACGAATAGCCTCATCATAATTGCAC
TGATCTTTACTAAGGCACTGACCTTTATAAGGAGTAAGCT
AGACAAGTGCAATAGATGCTTTCCAAACATACTTAGTATA
TTCCTGAAAGGTGTCATGAAAAAGAAATACGCACCTTAAT
GATTCAGGTTTACATGTCAGCAGTAAACGGGAAGCAGTAC
ATCATTAAAGTAAGTTTTGTTTTTGGCGCTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations