Transcript

nr2f6b-201

ID
ZDB-TSCRIPT-090929-11289
Name
nr2f6b-201
Previous Names
  • nr2f6b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028848 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028848|OTTDARG00000022417|ZDB-GENE-040426-2351 nr2f6b|OTTDARP00000023593 nr2f6-001 LG_none CT573239.9,BX248501.7 Danio rerio protein_coding KNOWN, 2382 bp
CGAAGCTTGTTGGCCAGTCACCACAGACGCTCGGGTCAGC
TGTCTCTCCTGACCGCTGGATCTCATGATTTACTGATGAA
TGGAGAAAGGCAAGGGACGGGAAGCAGCAAATGGTTAAAA
GAGCTTTGCTTTGGCTCCTAGGAATGCTGAGGCCCTGGAG
ACCATACAGCTGGACACACCGGCACTAACAAAACAAGCTT
AAAGGGATTCGCTCCAGGGCGGCTCTGAATTCTCGACGCA
GGAAGGTTTCTCGAGCAGCTCCTGCTGGTGTACACAGAGA
TGGCCATGGTGAGCGGGGGATGGGCCAACCCCAATGGCAG
TGCTAATGGACTCGGTGAGAAAGGTTACCTGCGGGGGGAG
GAGGAGGGAAGCTCGCCCCAGGCAGGGAACAGCGATGTGG
AAGGTGGCGAGGAGGACAAGGCCTGCGTGGTGGACTGTGT
TGTGTGTGGAGACAAATCCAGCGGGAAGCACTATGGTGTT
TTCACCTGTGAAGGGTGCAAGAGTTTCTTCAAAAGGAGCA
TCAGACGGAACCTCAACTACACCTGCAGATCAAACAGAGA
ATGTCAGATTGATCAGCATCACCGTAACCAGTGTCAGTAC
TGCCGTCTGAAGAAGTGCTTCCGGGTCGGTATGAGGAAAG
AAGCTGTTCAGCGTGGCCGAATTCCTCCATCCCACGCAGG
CATCAGCCCAGCCTCCATGGTAGGAGCAGGTGGTGATGTT
GGAGGAGGTCCGGGCATGGGTGCTGATTTTTTTAATGGTC
AGCCAGTGTCTGAACTCATCTCTCAACTACTGAGAGCAGA
GCCGTACCCCAACAGCCGTTATGGAGCCCAGTGTGGCCAG
CAGCTCCAAGGCGCCAACAGCTCCATGATGGGCATTGACA
ATATATGTGAGCTTGCAGCCCGGCTGCTGTTCAGCACTAT
TGAGTGGGCCAGGAATATTCCCTATTTTCCTGACCTGCCA
GTGTCAGAGCAGGTGGCCCTTCTGAGGCTCAGCTGGAGTG
AACTGTTTATCCTGAATGCAGCTCAGTCGGCGCTGCCCCT
GCACACGGCCCCTCTGCTGGCAGCTGCAGGGTTTCACTCC
TCCCCTATGCCCGCTGATCGCGTCGTGTCCTTCATGGACC
AGGTGCGGGTCTTTCAGGACCAGGTGGACAAGCTGACACG
ACTGCAGGTGGATTCTGTTGAATACAGCTGTCTGAAAGCC
ATCGCTCTGTTCTCACCAGATGCATGCGGGCTGTCGGATC
CAGCGCACGTCGAGAGCTTGCAGGAGAAAGCACAGGTGGC
CCTGACCGAATACGAGCGGATGCAGTATCCAGGCCAGCCC
CAGCGGTTCGGCCGGCTCCTGCTGCGACTTCCCGCTCTGA
GAGCCGTTCCCGCCAACCTCATCTCTCAACTCTTCTTCAT
GCGGCTGGTTGGCAAGACGCCAATCGAAACTCTAATCCGG
GACATGCAGCTCTCTGGAAGCTCCATCAGCTGGCCGTATG
TGCCTGGACAGTAGACGAACAATCAGAGGACTTGTTCCTA
TGTCCCATCTCAGGCTGCTCCCATGATTCCACAGTAACTG
TGCAGATAGATGTCGTGTGTGGGTTTTGTCGATGGTGTAT
ATATATATATATGACTAAAGGTGGATGACGCATATGTTCC
TATGCAGTTTAATTGAGCCATCCAGTACCAGGATACCTCA
TGTTTTCTGTCATGAGCATCAACAAATTCTCTCAAAAAAC
ATTTGACAAGATGAATGATAAACAAAGGACTGACTATGAA
GTATTTGATCCCAAGCTTTAAAAGGATAACCTTCTTTTTG
AGAGCATAGCGAACTACTTTAAAGCTAGTGTAGATTAAGT
GTACTTTAAGAATCTTTATAACAGACAGCATTTGTGAGTC
AAAAATGTTGGGAAATATACTTGAAAAATCAGTGAATGGC
TATATTTGGAATGGGATACTAGCATACTCCACACTACTGT
ATACTGCTTTATATTAAAAATGGTCAAAACGTACGAAATA
TGCAACATTTCATGTATCAAACAGTACTATGCTACACTGC
TGTCACGTGACCTCATGATATTGCATGTTTATGCTGCGCT
ACATTTAGGATACAGTAATCTGTGCAGTGCTGCTCAGGTT
ATGTTTAGCATATTTTGGCAAATGGTCATCCAGGTATTAT
ACAGATACATACTATGCACAGTGAACATACTATATAATGC
AGAGATATTAAGAGTAGTATGTTAGTATGCTGTTCTGAAC
ATAGTCAGTGTCCTCGATTGTCCTATTTAAACAGGTTTTG
TGAATTTTTCATTGGGGTGAGGACATGGTTGAGAGTTTTA
CATTGCCGACAGTGGGAAGTATTAAGTATTTTTGCATTAT
AAAAATAAAAAGAATAAAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations